WormBase Tree Display for Variation: WBVar00092811
expand all nodes | collapse all nodes | view schema
WBVar00092811 | Name | Public_name | ok1603 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F56A11.1.1:c.54_388-1270delinsATTTGGCAAATTTGGCAAATTTGCCGGCAAATTTGGCAAATTTGCCTA | ||||||||
HGVSg | CHROMOSOME_IV:g.572876_574778delinsATTTGGCAAATTTGGCAAATTTGCCGGCAAATTTGGCAAATTTGCCTA | ||||||||
Sequence_details | SMap | S_parent | Sequence | F56A11 | |||||
Flanking_sequences | aaacataccagatgttttgcagcttctcga | gcaaatttggcaaatttgccgagctcggca | |||||||
Mapping_target | F56A11 | ||||||||
Type_of_mutation | Insertion | ATTTGGCAAATTTGGCAAATTTGCCGGCAAATTTGGCAAATTTGCCTA | |||||||
Deletion | |||||||||
PCR_product | OK1603_external | ||||||||
OK1603_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00036391 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001579 | |||||||
Transcript | F56A11.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F56A11.1.1:c.54_388-1270delinsATTTGGCAAATTTGGCAAATTTGCCGGCAAATTTGGCAAATTTGCCTA | ||||||||
cDNA_position | 61-? | ||||||||
CDS_position | 54-? | ||||||||
Protein_position | 18-? | ||||||||
Intron_number | 3-5/13 | ||||||||
Exon_number | 3-5/14 | ||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Mapping_data | In_multi_point | 5641 | ||||||
Description | Phenotype | WBPhenotype:0000384 | Paper_evidence | WBPaper00032090 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 21% PDE axons failed to reach the VCN or reached it at a >45 angle from the PDE cell body (n=237). | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006747 | PATO:0000460 | Paper_evidence | WBPaper00032090 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay (2) | |||||||||
WBPhenotype:0000640 | Paper_evidence | WBPaper00032090 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00032090 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are slightly Unc. | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00032907 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are similar in profile to gex-2(tr116), data not shown. | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00032090 | |||||||
WBPaper00032907 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are similar in profile to gex-2(tr116), data not shown. | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00032907 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | HSN axons are occasionally misguided. These defects can be rescued by HSN-specific expression of GEX-2 driven by the unc-86 promoter. | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00032907 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001774 | Paper_evidence | WBPaper00032090 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00032090 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001930 | Paper_evidence | WBPaper00032907 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals display fewer dorsal and ventral muscle arms compared to control animals. These defects can be rescued by muscle-expressed GEX-2. | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000180 | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 0% axons were prematurely terminated and thickened (n=237). | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006747 | PATO:0000460 | Paper_evidence | WBPaper00032090 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Phenotypes were scored for maternally rescued progeny. | Paper_evidence | WBPaper00032090 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00032090 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 0% cell bodies and axons displayed a spread morphology or ectopic lamellipodia/filopodia-like structure (n=237). | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006747 | PATO:0000460 | Paper_evidence | WBPaper00032090 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Phenotypes were scored for maternally rescued progeny. | Paper_evidence | WBPaper00032090 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002490 | Paper_evidence | WBPaper00032090 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 2% ectopic axon branches emanated from axons that were not misguided (n=237). | Paper_evidence | WBPaper00032090 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006747 | PATO:0000460 | Paper_evidence | WBPaper00032090 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Phenotypes were scored for maternally rescued progeny. | Paper_evidence | WBPaper00032090 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00032090 | ||||||||
WBPaper00032907 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |