WormBase Tree Display for Variation: WBVar00092848

WBVar00092848 Name: Public_name: ok1640
    Other_name: F49E12.1.1:c.419_1533-162del
    HGVSg: CHROMOSOME_II:g.8401649_8404024del
  Sequence_details: SMap: S_parent: Sequence: F49E12
    Flanking_sequences: tctcttgataagtctgtagatggtaaacgt ggaagcactgattgatggaacaatctggag
    Mapping_target: F49E12
    Type_of_mutation: Deletion
    PCR_product: OK1640_external
      OK1640_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00032135
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00009897
    Transcript: F49E12.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F49E12.1.1:c.419_1533-162del
        cDNA_position: 423-?
        CDS_position: 419-?
        Protein_position: 140-?
        Intron_number: 5-13/17
        Exon_number: 5-13/18
    Interactor: WBInteraction000521037
      WBInteraction000521314
  Isolation: Mutagen: EMS
  Description: Phenotype: WBPhenotype:0000583 Paper_evidence: WBPaper00044963
        Curator_confirmed: WBPerson712
        Remark: skpo-1 mutant young adults ranged from very dumpy (16.5%), to slightly dumpy (32.9%), to wild type (50.6%) in appearance. Paper_evidence: WBPaper00044963
            Curator_confirmed: WBPerson712
        Penetrance: Incomplete: Paper_evidence: WBPaper00044963
              Curator_confirmed: WBPerson712
      WBPhenotype:0001012 Paper_evidence: WBPaper00044963
        Curator_confirmed: WBPerson712
        Remark: E. faecalis infected mutant animals released significantly greater amounts of H2O2, to wild-type animals. No difference in H2O2 release was observed on E. coli. Paper_evidence: WBPaper00044963
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: with or without cdc-25.1 RNAi treatment Paper_evidence: WBPaper00044963
              Curator_confirmed: WBPerson712
      WBPhenotype:0001013 Paper_evidence: WBPaper00044963
        Curator_confirmed: WBPerson712
        Remark: Animals were very susceptible to E. faecalis compared to wild-type N2 animals. In addition animals exhibited a significant "bagging" phenotype - hatching of embryos inside the hermaphrodite that had failed to be expelled, when the skpo-1 mutant animals were exposed to E. faecalis. Interestingly, we observed no significant difference in survival between cdc-25.1 RNAi skpo-1 mutants and cdc-25.1 RNAi wild-type animals when exposed to P. aeruginosa. Susceptibility was independent of dumpy appearance. Paper_evidence: WBPaper00044963
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: with or without cdc-25.1 RNAi treatment Paper_evidence: WBPaper00044963
              Curator_confirmed: WBPerson712
      WBPhenotype:0001171 Paper_evidence: WBPaper00044963
        Curator_confirmed: WBPerson712
        Remark: Regardless of whether skpo-1 mutant worms were sterile, from cdc-25.1 RNAi treatment or fecund (no treatment), they displayed a slight reduction in lifespan, relative to wild type, when exposed to live E. coli, OP50. Shortened lifespan was also observed for treated worms on heat-killed OP50. Paper_evidence: WBPaper00044963
            Curator_confirmed: WBPerson712
      WBPhenotype:0002164 Paper_evidence: WBPaper00044963
        Curator_confirmed: WBPerson712
        Remark: By qRT-PCR, expression of clec-60 was significantly higher in the skpo-1 mutant and there was a trend toward increased expression of clec-42, which was not statistically significant. No significant difference in the expression of clec-35 and -71 was observed between the wild type and skpo-1 mutants exposed to E. faecalis. Paper_evidence: WBPaper00044963
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000025 Paper_evidence: WBPaper00044963
        Curator_confirmed: WBPerson712
        Remark: No blistering of the cuticle was ever observed. Paper_evidence: WBPaper00044963
            Curator_confirmed: WBPerson712
        Penetrance: Incomplete: Paper_evidence: WBPaper00044963
              Curator_confirmed: WBPerson712
      WBPhenotype:0001819 Paper_evidence: WBPaper00044963
        Curator_confirmed: WBPerson712
        Remark: No significant difference in CFUs (colony forming units) perworm between the wild-type and skpo-1 mutant animals was observed after either 12 or 36 hours of exposure to E. faecalis. Paper_evidence: WBPaper00044963
            Curator_confirmed: WBPerson712
  Reference: WBPaper00044963
  Remark: Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele