WormBase Tree Display for Variation: WBVar00092993
expand all nodes | collapse all nodes | view schema
WBVar00092993 | Name | Public_name | ok1794 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y54F10AL.2c.1:c.3117+109_3239-137del | |||||||
Y54F10AL.2a.1:c.3183+109_3305-137del | ||||||||
HGVSg | CHROMOSOME_III:g.2484395_2485314del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y54F10AL | ||||
Flanking_sequences | caattaaaaattttttttcttgattttcta | aaaattgtgtctaggggtgaaaaattgcga | ||||||
Mapping_target | Y54F10AL | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK1794_external | |||||||
OK1794_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00036497 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00004884 | ||||||
Transcript | Y54F10AL.2c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y54F10AL.2c.1:c.3117+109_3239-137del | |||||||
Intron_number | 15-16/18 | |||||||
Exon_number | 16/19 | |||||||
Y54F10AL.2a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y54F10AL.2a.1:c.3183+109_3305-137del | |||||||
Intron_number | 16-17/19 | |||||||
Exon_number | 17/20 | |||||||
Interactor | WBInteraction000536768 | |||||||
WBInteraction000536771 | ||||||||
WBInteraction000536775 | ||||||||
Isolation | Mutagen | EMS | ||||||
Description | Phenotype | WBPhenotype:0000030 | Paper_evidence | WBPaper00041065 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "The smg-1, smg-4, and smg-6 mutants exhibited synthetic growth defects upon silencing of ire-1 (Fig. S7)." | Paper_evidence | WBPaper00041065 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | ire-1(RNAi) | Paper_evidence | WBPaper00041065 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000136 | Paper_evidence | WBPaper00041065 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "To assess whether ER protein-folding homeostasis requires NMD-mediated mRNA surveillance, we analyzed deletions of the NMD genes smg-1, smg-4, and smg-6 in the zcIs4 transgenic hsp-4 GFP reporter strain. All strains displayed greater GFP fluorescence compared the parental zcIs4 strain (Fig. 2A and Fig. S6), and qRT-PCR revealed that the expression of endogenous hsp-4 mRNA was constitutively elevated in the smg-1(tm849) and smg-6(ok1794) mutant strains compared the wild type N2 (Fig. 2B)." | Paper_evidence | WBPaper00041065 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00041065 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "To assess whether ER protein-folding homeostasis requires NMD-mediated mRNA surveillance, we analyzed deletions of the NMD genes smg-1, smg-4, and smg-6 in the zcIs4 transgenic hsp-4 GFP reporter strain. All strains displayed greater GFP fluorescence compared the parental zcIs4 strain (Fig. 2A and Fig. S6), and qRT-PCR revealed that the expression of endogenous hsp-4 mRNA was constitutively elevated in the smg-1(tm849) and smg-6(ok1794) mutant strains compared the wild type N2 (Fig. 2B)." | Paper_evidence | WBPaper00041065 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | zcIs4 [Phsp-4::GFP] | Paper_evidence | WBPaper00041065 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001485 | Paper_evidence | WBPaper00041065 | ||||||
Curator_confirmed | WBPerson4260 | |||||||
Reference | WBPaper00041065 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |