WormBase Tree Display for Variation: WBVar00092997
expand all nodes | collapse all nodes | view schema
| WBVar00092997 | Name | Public_name | ok1799 | ||||
|---|---|---|---|---|---|---|---|
| HGVSg | CHROMOSOME_I:g.7801621_7802315del | ||||||
| Sequence_details | SMap | S_parent | Sequence | D2005 | |||
| Flanking_sequences | cggtgaagcaggaaagatcaggtaggggta | aataagaaacattgaggaatttatgaatga | |||||
| Mapping_target | D2005 | ||||||
| Type_of_mutation | Deletion | ||||||
| PCR_product | OK1799_external | ||||||
| OK1799_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00036501 | ||||||
| Laboratory | RB | ||||||
| Person | WBPerson46 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00003746 | |||||
| Transcript | D2005.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| cDNA_position | ?-92 | ||||||
| CDS_position | ?-78 | ||||||
| Protein_position | ?-26 | ||||||
| Intron_number | 2/5 | ||||||
| Exon_number | 1-3/6 | ||||||
| Isolation | Mutagen | EMS | |||||
| Description | Phenotype (17) | ||||||
| Phenotype_not_observed | WBPhenotype:0002432 | Paper_evidence | WBPaper00050011 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Null mutation of this neuropeptide had little or no effect on stress-induced sleep. To determine whether ALA-enriched neuropeptides are necessary for stress-induced sleep, we assayed locomotion, head movement, pharyngeal pumping, avoidance response, and defecation before and 30 min after heat shock. Single-null mutants were indistinguishable from wild-type with respect to pumping, locomotion, and head movement after heat shock. | Paper_evidence | WBPaper00050011 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00043908 | ||||||
| WBPaper00050011 | |||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
