WormBase Tree Display for Variation: WBVar00093247
expand all nodes | collapse all nodes | view schema
WBVar00093247 | Evidence | Paper_evidence | WBPaper00040574 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ok2060 | |||||
HGVSg | CHROMOSOME_I:g.9658185_9659406del | ||||||
Sequence_details | SMap | S_parent | Sequence | C03D6 | |||
Flanking_sequences | agctggagttttcaaccactttttacggga | ctgatgaggatccagtcgccgagccggttg | |||||
Mapping_target | C03D6 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | ok2060_external | ||||||
ok2060_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00032355 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00219796 | |||||
WBGene00007277 | |||||||
Transcript | C03D6.5.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
cDNA_position | ?-463 | ||||||
CDS_position | ?-463 | ||||||
Protein_position | ?-155 | ||||||
Intron_number | 1-2/5 | ||||||
Exon_number | 1-3/6 | ||||||
C03D6.9.1 | VEP_consequence | transcript_ablation | |||||
VEP_impact | HIGH | ||||||
Exon_number | 1/1 | ||||||
Interactor | WBInteraction000501351 | ||||||
Isolation | Mutagen | EMS | |||||
Description | Phenotype_not_observed | WBPhenotype:0000216 | Paper_evidence | WBPaper00040574 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | MI and e3D were correctly specified. | Paper_evidence | WBPaper00040574 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00040574 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |