WormBase Tree Display for Variation: WBVar00093292
expand all nodes | collapse all nodes | view schema
| WBVar00093292 | Name | Public_name | ok2109 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| HGVSg | CHROMOSOME_IV:g.7983676_7985652delinsTTTTTAAAA | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F57H12 | |||||
| Flanking_sequences | tggtacccatctctctctctctctccgtcc | aatttatttttaaaaaattatattcggacc | |||||||
| Mapping_target | F57H12 | ||||||||
| Type_of_mutation | Insertion | TTTTTAAAA | |||||||
| Deletion | |||||||||
| PCR_product | ok2109_external | ||||||||
| ok2109_internal | |||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00032389 | ||||||||
| Laboratory | RB | ||||||||
| Person | WBPerson46 | ||||||||
| KO_consortium_allele | |||||||||
| Status | Live | ||||||||
| Affects (3) | |||||||||
| Isolation | Mutagen | EMS | |||||||
| Description | Phenotype | WBPhenotype:0000315 | Paper_evidence | WBPaper00037771 | |||||
| Curator_confirmed | WBPerson209 | ||||||||
| Remark | e.g. Figure 5G | Paper_evidence | WBPaper00037771 | ||||||
| Curator_confirmed | WBPerson209 | ||||||||
| WBPhenotype:0001221 | Paper_evidence | WBPaper00037771 | |||||||
| Curator_confirmed | WBPerson209 | ||||||||
| Remark | Figure 5F | Paper_evidence | WBPaper00037771 | ||||||
| Curator_confirmed | WBPerson209 | ||||||||
| WBPhenotype:0001224 | Paper_evidence | WBPaper00044649 | |||||||
| Curator_confirmed | WBPerson9270 | ||||||||
| Remark | Outgrowth of ALM posterior neurite; outgrowth of PLM posterior neurite (Figure S1D,E) | Paper_evidence | WBPaper00044649 | ||||||
| Curator_confirmed | WBPerson9270 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00044649 | ||||
| Curator_confirmed | WBPerson9270 | ||||||||
| WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00044649 | ||||||
| Curator_confirmed | WBPerson9270 | ||||||||
| GO_term | GO:0007409 | PATO:0000460 | Paper_evidence | WBPaper00044649 | |||||
| Curator_confirmed | WBPerson9270 | ||||||||
| WBPhenotype:0002364 | Paper_evidence | WBPaper00044649 | |||||||
| Curator_confirmed | WBPerson9270 | ||||||||
| Remark | Spontaneous axon degeneration in adult animals, predominantly affecting PLM, but also ALM and AVM to a lessor degree (Figure 1C) | Paper_evidence | WBPaper00044649 | ||||||
| Curator_confirmed | WBPerson9270 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00044649 | ||||
| Curator_confirmed | WBPerson9270 | ||||||||
| WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00044649 | ||||||
| Curator_confirmed | WBPerson9270 | ||||||||
| WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00044649 | ||||||
| Curator_confirmed | WBPerson9270 | ||||||||
| Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00044649 | |||||
| Curator_confirmed | WBPerson9270 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000633 | Paper_evidence | WBPaper00045955 | ||||||
| Curator_confirmed | WBPerson557 | ||||||||
| Remark | Animals did not have PLM branch defects. | Paper_evidence | WBPaper00045955 | ||||||
| Curator_confirmed | WBPerson557 | ||||||||
| Disease_info | Models_disease | DOID:1289 | |||||||
| Models_disease_in_annotation | WBDOannot00000611 | ||||||||
| Reference | WBPaper00037771 | ||||||||
| WBPaper00044649 | |||||||||
| WBPaper00045955 | |||||||||
| WBPaper00065849 | |||||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
| Method | KO_consortium_allele |
