WormBase Tree Display for Variation: WBVar00093292
expand all nodes | collapse all nodes | view schema
WBVar00093292 | Name (2) | ||||||||
---|---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | F57H12 | |||||
Flanking_sequences | tggtacccatctctctctctctctccgtcc | aatttatttttaaaaaattatattcggacc | |||||||
Mapping_target | F57H12 | ||||||||
Type_of_mutation | Insertion | TTTTTAAAA | |||||||
Deletion | |||||||||
PCR_product | ok2109_external | ||||||||
ok2109_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00032389 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003178 | |||||||
WBGene00000183 | |||||||||
Transcript | F57H12.1.1 | VEP_consequence | 3_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | 764-? | ||||||||
Exon_number | 7/7 | ||||||||
F57H12.7b.1 | VEP_consequence | transcript_ablation | |||||||
VEP_impact | HIGH | ||||||||
Intron_number | 1-2/2 | ||||||||
Exon_number | 1-3/3 | ||||||||
F57H12.7a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
Intron_number | 2-5/6 | ||||||||
Exon_number | 3-7/7 | ||||||||
Interactor | WBInteraction000521007 | ||||||||
Isolation | Mutagen | EMS | |||||||
Description | Phenotype | WBPhenotype:0000315 | Paper_evidence | WBPaper00037771 | |||||
Curator_confirmed | WBPerson209 | ||||||||
Remark | e.g. Figure 5G | Paper_evidence | WBPaper00037771 | ||||||
Curator_confirmed | WBPerson209 | ||||||||
WBPhenotype:0001221 | Paper_evidence | WBPaper00037771 | |||||||
Curator_confirmed | WBPerson209 | ||||||||
Remark | Figure 5F | Paper_evidence | WBPaper00037771 | ||||||
Curator_confirmed | WBPerson209 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00044649 | |||||||
Curator_confirmed | WBPerson9270 | ||||||||
Remark | Outgrowth of ALM posterior neurite; outgrowth of PLM posterior neurite (Figure S1D,E) | Paper_evidence | WBPaper00044649 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00044649 | ||||
Curator_confirmed | WBPerson9270 | ||||||||
WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00044649 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
GO_term | GO:0007409 | PATO:0000460 | Paper_evidence | WBPaper00044649 | |||||
Curator_confirmed | WBPerson9270 | ||||||||
WBPhenotype:0002364 | Paper_evidence | WBPaper00044649 | |||||||
Curator_confirmed | WBPerson9270 | ||||||||
Remark | Spontaneous axon degeneration in adult animals, predominantly affecting PLM, but also ALM and AVM to a lessor degree (Figure 1C) | Paper_evidence | WBPaper00044649 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00044649 | ||||
Curator_confirmed | WBPerson9270 | ||||||||
WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00044649 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00044649 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00044649 | |||||
Curator_confirmed | WBPerson9270 | ||||||||
Phenotype_not_observed | WBPhenotype:0000633 | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Animals did not have PLM branch defects. | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Disease_info | Models_disease | DOID:1289 | |||||||
Models_disease_in_annotation | WBDOannot00000611 | ||||||||
Reference | WBPaper00037771 | ||||||||
WBPaper00044649 | |||||||||
WBPaper00045955 | |||||||||
WBPaper00065849 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |