WormBase Tree Display for Variation: WBVar00093304
expand all nodes | collapse all nodes | view schema
WBVar00093304 | Evidence | Paper_evidence | WBPaper00040574 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ok2125 | |||||
HGVSg | CHROMOSOME_II:g.4701663_4703370delinsTAAAGAAATCAGTAAAGAA | ||||||
Sequence_details | SMap | S_parent | Sequence | F10G7 | |||
Flanking_sequences | tggaaaaataaataaataaatacgaagaag | agtaaagaaattgatttaaaaagaaaataa | |||||
Mapping_target | F10G7 | ||||||
Type_of_mutation | Insertion | TAAAGAAATCAGTAAAGAA | |||||
Deletion | |||||||
PCR_product | ok2125_external | ||||||
ok2125_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00036793 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00017372 | |||||
WBGene00006817 | |||||||
Transcript | F10G7.3.1 | VEP_consequence | transcript_ablation | ||||
VEP_impact | HIGH | ||||||
Intron_number | 1-3/4 | ||||||
Exon_number | 1-5/5 | ||||||
F10G7.9b.1 | VEP_consequence | 3_prime_UTR_variant | |||||
VEP_impact | MODIFIER | ||||||
cDNA_position | 2377-? | ||||||
Exon_number | 14/14 | ||||||
F10G7.9a.1 | VEP_consequence | 3_prime_UTR_variant | |||||
VEP_impact | MODIFIER | ||||||
cDNA_position | 2324-? | ||||||
Exon_number | 13/13 | ||||||
Interactor | WBInteraction000501351 | ||||||
Isolation | Mutagen | EMS | |||||
Description | Phenotype_not_observed | WBPhenotype:0000216 | Paper_evidence | WBPaper00040574 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | MI and e3D were correctly specified. | Paper_evidence | WBPaper00040574 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00040574 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |