WormBase Tree Display for Variation: WBVar00093355
expand all nodes | collapse all nodes | view schema
WBVar00093355 | Name | Public_name | ok2189 | ||||
---|---|---|---|---|---|---|---|
Other_name | Y71G12B.4.1:c.277_368-463del | ||||||
HGVSg | CHROMOSOME_I:g.1809624_1810599del | ||||||
Sequence_details | SMap | S_parent | Sequence | Y71G12B | |||
Flanking_sequences | tgggattgtggagaaatgaataagccggat | ttgtccgtgtagagtacacgactttcccag | |||||
Mapping_target | Y71G12B | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | ok2189_external | ||||||
ok2189_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00032413 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00022144 | |||||
Transcript | Y71G12B.4.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | Y71G12B.4.1:c.277_368-463del | ||||||
cDNA_position | 304-? | ||||||
CDS_position | 277-? | ||||||
Protein_position | 93-? | ||||||
Intron_number | 3/4 | ||||||
Exon_number | 3/5 | ||||||
Isolation | Mutagen | EMS | |||||
Description | Phenotype | WBPhenotype:0001758 | Paper_evidence | WBPaper00053772 | |||
Curator_confirmed | WBPerson40249 | ||||||
Remark | Reduced number of mature C-terminally amidated neuropeptides, with a higher prevalency of the unprocessed glycine-extended neuropeptides. PGHM-1 is considered as a part of the neuropeptide amidation machinery in C. elegans | Paper_evidence | WBPaper00053772 | ||||
Curator_confirmed | WBPerson40249 | ||||||
Reference | WBPaper00053772 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |