WormBase Tree Display for Variation: WBVar00093487
expand all nodes | collapse all nodes | view schema
| WBVar00093487 | Evidence | Paper_evidence | WBPaper00031936 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | ok2334 | |||||||
| Other_name | Y71H2B.7.1:c.85-160_1012del | ||||||||
| Y71H2B.10.1:c.2466+510_2467-1834del | |||||||||
| HGVSg | CHROMOSOME_III:g.2587340_2589032del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | Y71H2B | |||||
| Flanking_sequences | tttccaattagtggtggtgatttttgcctg | agggaaaaaagggaaaaccggagaattatg | |||||||
| Mapping_target | Y71H2B | ||||||||
| Type_of_mutation | Deletion | ||||||||
| PCR_product | ok2334_external | ||||||||
| ok2334_internal | |||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00032491 | ||||||||
| Laboratory | RB | ||||||||
| Person | WBPerson46 | ||||||||
| KO_consortium_allele | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00022196 | |||||||
| WBGene00000160 | |||||||||
| Transcript | Y71H2B.7.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | Y71H2B.7.1:c.85-160_1012del | ||||||||
| cDNA_position | ?-1048 | ||||||||
| CDS_position | ?-1012 | ||||||||
| Protein_position | ?-338 | ||||||||
| Intron_number | 2-6/7 | ||||||||
| Exon_number | 3-7/8 | ||||||||
| Y71H2B.10.1 | VEP_consequence | intron_variant | |||||||
| VEP_impact | MODIFIER | ||||||||
| HGVSc | Y71H2B.10.1:c.2466+510_2467-1834del | ||||||||
| Intron_number | 7/10 | ||||||||
| Isolation | Mutagen | EMS | |||||||
| Description | Phenotype (14) | ||||||||
| Phenotype_not_observed | WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Animals with mutations in individual G protein subunits respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00043908 | ||||||||
| WBPaper00031936 | |||||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
| Method | KO_consortium_allele |
