WormBase Tree Display for Variation: WBVar00094074
expand all nodes | collapse all nodes | view schema
WBVar00094074 | Name | Public_name | ok2987 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | K08F8.1b.1:c.242_929+15del | |||||||
K08F8.1a.1:c.242_929+15del | ||||||||
K08F8.1d.1:c.242_929+15del | ||||||||
HGVSg | CHROMOSOME_II:g.8745268_8746021del | |||||||
Sequence_details | SMap | S_parent | Sequence | K08F8 | ||||
Flanking_sequences | tgctctttcagcgttcattggttctgaatg | ttttgtcttctagattctataaatcttatt | ||||||
Mapping_target | K08F8 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok2987_external | |||||||
ok2987_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00032888 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00010681 | ||||||
Transcript | K08F8.1c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
Intron_number | 1-2/5 | |||||||
Exon_number | 1-2/6 | |||||||
K08F8.1d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | K08F8.1d.1:c.242_929+15del | |||||||
cDNA_position | 300-? | |||||||
CDS_position | 242-? | |||||||
Protein_position | 81-? | |||||||
Intron_number | 4-5/8 | |||||||
Exon_number | 4-5/9 | |||||||
K08F8.1e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 1-2/3 | |||||||
Exon_number | 1-2/4 | |||||||
K08F8.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | K08F8.1b.1:c.242_929+15del | |||||||
cDNA_position | 300-? | |||||||
CDS_position | 242-? | |||||||
Protein_position | 81-? | |||||||
Intron_number | 4-5/8 | |||||||
Exon_number | 4-5/9 | |||||||
K08F8.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | K08F8.1a.1:c.242_929+15del | |||||||
cDNA_position | 294-? | |||||||
CDS_position | 242-? | |||||||
Protein_position | 81-? | |||||||
Intron_number | 4-5/9 | |||||||
Exon_number | 4-5/10 | |||||||
Interactor | WBInteraction000525229 | |||||||
Isolation | Mutagen | EMS | ||||||
Description | Phenotype | WBPhenotype:0000273 | Paper_evidence | WBPaper00046636 | ||||
Curator_confirmed | WBPerson557 | |||||||
Remark | mak-1(ok2987) worms show slightly reduced motility. | Paper_evidence | WBPaper00046636 | |||||
Curator_confirmed | WBPerson557 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00046636 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001203 | Paper_evidence | WBPaper00046636 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | mak-1 mutants are partially resistant to nicotine. The likely null allele, mak-1(ok2987), shows greater resistance than mak-1(tm3445). | Paper_evidence | WBPaper00046636 | |||||
Curator_confirmed | WBPerson557 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00046636 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Animals exposed to a solution of 0.1 percent nicotine. | Paper_evidence | WBPaper00046636 | ||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_not_observed | WBPhenotype:0001408 | Paper_evidence | WBPaper00046636 | |||||
Curator_confirmed | WBPerson557 | |||||||
Remark | To examine sarcomere morphology the authors looked at the localization of the following proteins: UNC-22, UNC-52, UNC-112, UNC-95, ATN-1, UNC-89 and MHC A. Antibodies to all these proteins showed normal localization in mak-1(ok2987) animals. | Paper_evidence | WBPaper00046636 | |||||
Curator_confirmed | WBPerson557 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00046636 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001889 | Paper_evidence | WBPaper00046636 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | To examine sarcomere morphology the authors looked at the localization of the following proteins: UNC-22, UNC-52, UNC-112, UNC-95, ATN-1, UNC-89 and MHC A. Antibodies to all these proteins showed normal localization in mak-1(ok2987) animals. | Paper_evidence | WBPaper00046636 | |||||
Curator_confirmed | WBPerson557 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00046636 | |||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00046636 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |