WormBase Tree Display for Variation: WBVar00094697

WBVar00094697 Evidence: Paper_evidence: WBPaper00030897
  Name: Public_name: or195
    Other_name: or195ts
      T21E12.4b.1:c.6803C>T
      CE23997:p.Ser3200Leu
      CE51690:p.Ser2268Leu
      T21E12.4a.1:c.9599C>T
    HGVSg: CHROMOSOME_I:g.4397405C>T
  Sequence_details: SMap: S_parent: Sequence: T21E12
    Flanking_sequences: aacagaaggctgaagaagagaagaagttct ggagcaattgcagaaggagctcgcagagca
    Mapping_target: T21E12
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00030897
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00007309
    Laboratory: EU
    Status: Live
  Affects: Gene: WBGene00000962
    Transcript: T21E12.4a.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: T21E12.4a.1:c.9599C>T
        HGVSp: CE23997:p.Ser3200Leu
        cDNA_position: 9604
        CDS_position: 9599
        Protein_position: 3200
        Exon_number: 11/17
        Codon_change: tCg/tTg
        Amino_acid_change: S/L
      T21E12.4b.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: T21E12.4b.1:c.6803C>T
        HGVSp: CE51690:p.Ser2268Leu
        cDNA_position: 6803
        CDS_position: 6803
        Protein_position: 2268
        Exon_number: 7/12
        Codon_change: tCg/tTg
        Amino_acid_change: S/L
    Interactor (56)
  Isolation: Forward_genetics: Standard phenotypic screen Person_evidence: WBPerson3760
  Genetics: Interpolated_map_position: I -1.31005
  Description: Phenotype: WBPhenotype:0000050 Paper_evidence: WBPaper00030897
          WBPaper00032264
        Curator_confirmed: WBPerson712
          WBPerson2021
        Remark: When shifted to restrictive temperatures, hermaphrodites produce dead embryos Paper_evidence: WBPaper00032264
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00030897
          Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000003 PATO:0000460 Paper_evidence: WBPaper00030897
                  WBPaper00032264
                Curator_confirmed: WBPerson712
                  WBPerson2021
        Temperature_sensitive: Heat_sensitive: 23 Paper_evidence: WBPaper00030897
              Curator_confirmed: WBPerson712
            25C Paper_evidence: WBPaper00032264
              Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: L1 larvae were grown on L4440 control dsRNA-expressing bacterial strains at different temperatures. Paper_evidence: WBPaper00030897
              Curator_confirmed: WBPerson712
      WBPhenotype:0000961 Paper_evidence: WBPaper00030897
        Curator_confirmed: WBPerson712
        Remark: DYRB-1::GFP and DYLT-1::GFP localize to centrosomes and mitotic spindle poles in embryos from homozygous dhc-1 mutant worms. Localization is faint in embryos from WT. Paper_evidence: WBPaper00030897
            Curator_confirmed: WBPerson712
          DYRB-1::GFP and DYLT-1::GFP localize to centrosomes and mitotic spindle poles in embryos from heterozygous dhc-1 mutant worms. Signal is weaker than in embryos from dhc-1 homozygous worms shifted to 26C. No signal was seen in embryos from dhc-1 RNAi treated worms. Paper_evidence: WBPaper00030897
            Curator_confirmed: WBPerson712
        Variation_effect: Hypermorph_gain_of_function: Paper_evidence: WBPaper00030897
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000003 PATO:0000460 Paper_evidence: WBPaper00030897
                Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Worms were shifted to 26C for 3 hrs (DYRB-1) or 5 hrs (DYLT-1) before embryos were viewed. Paper_evidence: WBPaper00030897
              Curator_confirmed: WBPerson712
            Heterozygous dhc-1 worms were grown at 15C. Paper_evidence: WBPaper00030897
              Curator_confirmed: WBPerson712
          Temperature: 26C Paper_evidence: WBPaper00030897
              Curator_confirmed: WBPerson712
            15C Paper_evidence: WBPaper00030897
              Curator_confirmed: WBPerson712
      WBPhenotype:0001102 Paper_evidence: WBPaper00030897
        Curator_confirmed: WBPerson712
        Remark: P0 spindles are 30% length of WT spindles Paper_evidence: WBPaper00030897
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000003 PATO:0000460 Paper_evidence: WBPaper00030897
                Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Time-lapse video was used to monitor the first cell divisions in embryos from adults that were shifted from 23C to 26C for 3-5 hrs. Paper_evidence: WBPaper00030897
              Curator_confirmed: WBPerson712
          Temperature: 26C Paper_evidence: WBPaper00030897
              Curator_confirmed: WBPerson712
      WBPhenotype:0001130 Paper_evidence: WBPaper00030897
        Curator_confirmed: WBPerson712
        Penetrance: Incomplete: 89% Paper_evidence: WBPaper00030897
              Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000003 PATO:0000460 Paper_evidence: WBPaper00030897
                Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Time-lapse video was used to monitor the first cell divisions in embryos from adults that were shifted from 23C to 26C for 3-5 hrs. Paper_evidence: WBPaper00030897
              Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000436 Paper_evidence: WBPaper00028886
        Curator_confirmed: WBPerson48
        Remark: Localization of the synaptic protein SNB-1 is normal, based on expression analysis with SNB-1::VENUS. Paper_evidence: WBPaper00028886
            Curator_confirmed: WBPerson48
      WBPhenotype:0000679 Paper_evidence: WBPaper00028448
        Curator_confirmed: WBPerson712
        Remark: PKD-2::GFP localization is not different from wild type. Paper_evidence: WBPaper00028448
            Curator_confirmed: WBPerson712
      WBPhenotype:0000962 Paper_evidence: WBPaper00030801
        Curator_confirmed: WBPerson712
        Remark: Similar to the wild-type background, Ubi-1::PKD-2::GFP levels are greatly reduced in mutant males (data not shown). Paper_evidence: WBPaper00030801
            Curator_confirmed: WBPerson712
  Reference: WBPaper00028886
    WBPaper00032264
    WBPaper00028448
    WBPaper00030897
    WBPaper00030801
  Remark: Allele was previously curated as an H(2157) to L mutation. Paper_evidence: WBPaper00025116
  Method: Substitution_allele