WormBase Tree Display for Variation: WBVar00095012
expand all nodes | collapse all nodes | view schema
WBVar00095012 | Evidence | Paper_evidence | WBPaper00024579 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ox196 | |||||||
Other_name | CE31417:p.His214Arg | ||||||||
C17G1.6b.1:c.641A>G | |||||||||
CE38034:p.His214Arg | |||||||||
C17G1.6a.1:c.641A>G | |||||||||
HGVSg | CHROMOSOME_X:g.9948097T>C | ||||||||
Sequence_details | SMap | S_parent | Sequence | C17G1 | |||||
Flanking_sequences | atgagactctgcacgccttgggactttggc | cgaacagtcgagagatgatagagacaattt | |||||||
Mapping_target | C17G1 | ||||||||
Type_of_mutation | Substitution | a | g | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | EG | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003553 | |||||||
Transcript | C17G1.6b.1 (12) | ||||||||
C17G1.6a.1 (12) | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | X | 1.73126 | ||||||
Description | Phenotype | WBPhenotype:0000077 | Paper_evidence | WBPaper00024579 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Animals fail to open anterior end of old cuticle and crawl out, and partially shed cuticle forms a tight constriction around the animal. | Paper_evidence | WBPaper00024579 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00024579 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Paper_evidence | WBPaper00024579 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00024579 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000040 | PATO:0000460 | Paper_evidence | WBPaper00024579 | ||||
Curator_confirmed | WBPerson48 | ||||||||
WBls:0000026 | PATO:0000460 | Paper_evidence | WBPaper00024579 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBls:0000029 | PATO:0000460 | Paper_evidence | WBPaper00024579 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBls:0000037 | PATO:0000460 | Paper_evidence | WBPaper00024579 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Reference | WBPaper00024579 | ||||||||
Remark | a missense mutation in a His of the catalytic site, same penetrance and phenotype as nonsense and deletion alleles. Likely null. | Person_evidence | WBPerson128 | ||||||
Method | Substitution_allele |