WormBase Tree Display for Variation: WBVar00095018

WBVar00095018 Evidence: Paper_evidence: WBPaper00030754
  Name: Public_name: ox299
    Other_name (34)
    HGVSg: CHROMOSOME_IV:g.12781517T>A
  Sequence_details: SMap: S_parent: Sequence: ZK897
    Flanking_sequences: tgaaattgtatacagaagtgaagagtatga agcatttgaggataaagaattaggaaaagt
    Mapping_target: ZK897
    Type_of_mutation: Substitution: t a Paper_evidence: WBPaper00030754
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: EG
    Status: Live
  Affects: Gene: WBGene00006767
    Transcript (17)
  Genetics: Interpolated_map_position: IV 6.31882
  Description: Phenotype: WBPhenotype:0000643 Paper_evidence: WBPaper00030754
        Curator_confirmed: WBPerson712
        Remark: Only subtle defects were observed. Paper_evidence: WBPaper00030754
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0001410 Paper_evidence: WBPaper00030754
        Curator_confirmed: WBPerson712
        Remark: As assayed by the presence of a signal on a Western blot probed with an antibody generated against aa 42-304 of UNC-31. Paper_evidence: WBPaper00030754
            Curator_confirmed: WBPerson712
  Reference: WBPaper00030754
  Method: Substitution_allele