WormBase Tree Display for Variation: WBVar00095111
expand all nodes | collapse all nodes | view schema
WBVar00095111 | Evidence | Paper_evidence | WBPaper00002584 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | p671 | |||||||
Other_name | CE17780:p.Cys231Arg | ||||||||
F36F2.5.1:c.691T>C | |||||||||
HGVSg | CHROMOSOME_I:g.9023031T>C | ||||||||
Sequence_details | SMap | S_parent | Sequence | C31H5 | |||||
Flanking_sequences | tacatgacatggctctcactagttacttta | gttttttattcaatgcattttgtattccac | |||||||
Mapping_target | C31H5 | ||||||||
Type_of_mutation | Substitution | t | c | Paper_evidence | WBPaper00002584 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00003905 | ||||||||
WBStrain00030780 | |||||||||
Laboratory | PR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006525 | |||||||
Transcript | F36F2.5.1 (12) | ||||||||
Interactor | WBInteraction000504655 | ||||||||
WBInteraction000535464 | |||||||||
WBInteraction000535465 | |||||||||
WBInteraction000535466 | |||||||||
Genetics | Interpolated_map_position | I | 3.40468 | ||||||
Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00060588 | |||||
Curator_confirmed | WBPerson282 | ||||||||
WBPhenotype:0000295 | Paper_evidence | WBPaper00060588 | |||||||
Curator_confirmed | WBPerson282 | ||||||||
WBPhenotype:0000481 | Paper_evidence | WBPaper00059397 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The repulsion effect of the carvone enantiomers was reduced in tax-4mutants, suggesting that both enantiomers are sensed by tax-4-expressing sensory neurons. | Paper_evidence | WBPaper00059397 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00007883 | Paper_evidence | WBPaper00059397 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00060588 | |||||||
Curator_confirmed | WBPerson282 | ||||||||
WBPhenotype:0001042 | Paper_evidence | WBPaper00031992 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | All responses to NaCl upsteps and down-steps in ASEL and ASER were eliminated, as assayed by calcium imaging. | Paper_evidence | WBPaper00031992 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005663 | PATO:0000460 | Paper_evidence | WBPaper00031992 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | Calcium transients in ASE neurons were measured in response to NaCl concentration steps of 40mM from a baseline of 40 mM. | Paper_evidence | WBPaper00031992 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001315 | Paper_evidence | WBPaper00031999 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No light-induced currents in ASJ were observed. | Paper_evidence | WBPaper00031999 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005667 | PATO:0000460 | Paper_evidence | WBPaper00031999 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001438 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Defective in chemotaxis to volatile odorants including benzaldehyde, 2-butanone and isoamyl alcohol (Data not shown). | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001738 | Paper_evidence | WBPaper00031959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were defective in ammonium chemotaxis in water soluble assays when compared to che-1(p679) positive control animals (data not shown). | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00002091 | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For the water soluble chemotaxis assay, radial gradients of NH4Cl were established by diffusion in the agar. | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001764 | Paper_evidence | WBPaper00037908 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | The carbon dioxide-evoked calcium transients of BAG neurons were eliminated. | Paper_evidence | WBPaper00037908 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Acute CO2 avoidance is eliminated | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001787 | Paper_evidence | WBPaper00031999 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001790 | Paper_evidence | WBPaper00032060 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Both cooling- and warming-evoked thermoreceptor currents in AFD neurons were abolished while voltage-activated currents were essentially left unchanged. | Paper_evidence | WBPaper00032060 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005662 | PATO:0000460 | Paper_evidence | WBPaper00032060 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002014 | Paper_evidence | WBPaper00036207 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | GTP-gamma S stimulated inward current in ASJ was absent in the CNG channel mutants. Mastoparan elicited inward currents were blocked. | Paper_evidence | WBPaper00036207 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001587 | Paper_evidence | WBPaper00036207 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00004020 | Paper_evidence | WBPaper00036207 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002171 | Paper_evidence | WBPaper00042397 | |||||||
Curator_confirmed | WBPerson1928 | ||||||||
Remark | Animals are defective in chemotaxis towards attractive alkaline pH | Paper_evidence | WBPaper00042397 | ||||||
Curator_confirmed | WBPerson1928 | ||||||||
WBPhenotype:0002378 | Paper_evidence | WBPaper00054670 | |||||||
Curator_confirmed | WBPerson2706 | ||||||||
Remark | animals defective in their ability to avoid OP50 lawns contaminated with Microbacterium nematophilum | Paper_evidence | WBPaper00054670 | ||||||
Curator_confirmed | WBPerson2706 | ||||||||
Phenotype_not_observed | WBPhenotype:0001736 | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed no defect in acetate chemotaxis in water soluble assays when compared to che-1(p679) positive control animals (data not shown). | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00005057 | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For water soluble chemotaxis assays, radial gradients of NaAc were established by diffusion in agar. | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001897 | Paper_evidence | WBPaper00032087 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Loss-of-function mutations in the TAX-2 CNG channels do not affect the overall locomotion response to short wavelength light | Paper_evidence | WBPaper00032087 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032087 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (15) | |||||||||
Remark | Corrected from pr671 appeared In 2002 European Worm Meeting abstract | Person_evidence | WBPerson712 | ||||||
Method | Substitution_allele |