WormBase Tree Display for Variation: WBVar00095111
expand all nodes | collapse all nodes | view schema
WBVar00095111 | Evidence | Paper_evidence | WBPaper00002584 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | p671 | ||||||
Other_name (2) | ||||||||
HGVSg | CHROMOSOME_I:g.9023031T>C | |||||||
Sequence_details | SMap | S_parent | Sequence | C31H5 | ||||
Flanking_sequences | tacatgacatggctctcactagttacttta | gttttttattcaatgcattttgtattccac | ||||||
Mapping_target | C31H5 | |||||||
Type_of_mutation | Substitution | t | c | Paper_evidence | WBPaper00002584 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00003905 | |||||||
WBStrain00030780 | ||||||||
Laboratory | PR | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006525 | ||||||
Transcript | F36F2.5.1 (12) | |||||||
Interactor | WBInteraction000504655 | |||||||
WBInteraction000535464 | ||||||||
WBInteraction000535465 | ||||||||
WBInteraction000535466 | ||||||||
Genetics | Interpolated_map_position | I | 3.40468 | |||||
Description | Phenotype (15) | |||||||
Phenotype_not_observed | WBPhenotype:0001736 | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals showed no defect in acetate chemotaxis in water soluble assays when compared to che-1(p679) positive control animals (data not shown). | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00005057 | Paper_evidence | WBPaper00031959 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | For water soluble chemotaxis assays, radial gradients of NaAc were established by diffusion in agar. | Paper_evidence | WBPaper00031959 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001897 | Paper_evidence | WBPaper00032087 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Loss-of-function mutations in the TAX-2 CNG channels do not affect the overall locomotion response to short wavelength light | Paper_evidence | WBPaper00032087 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032087 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (15) | ||||||||
Remark | Corrected from pr671 appeared In 2002 European Worm Meeting abstract | Person_evidence | WBPerson712 | |||||
Method | Substitution_allele |