WormBase Tree Display for Variation: WBVar00095114
expand all nodes | collapse all nodes | view schema
WBVar00095114 | Evidence | Paper_evidence | WBPaper00005810 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | p674 | |||||||
Other_name | CE34280:p.Arg154Ter | ||||||||
CE40380:p.Arg213Ter | |||||||||
C55B7.12b.1:c.637C>T | |||||||||
C55B7.12a.1:c.460C>T | |||||||||
HGVSg | CHROMOSOME_I:g.6518330G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C55B7 | |||||
Flanking_sequences | ttttctcaaagttcttctcttgttactcat | gaaggtattagaggaagggtccattactat | |||||||
Mapping_target | C55B7 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030783 | ||||||||
Laboratory | PR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000483 | |||||||
Transcript | C55B7.12a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C55B7.12a.1:c.460C>T | ||||||||
HGVSp | CE34280:p.Arg154Ter | ||||||||
cDNA_position | 460 | ||||||||
CDS_position | 460 | ||||||||
Protein_position | 154 | ||||||||
Exon_number | 4/5 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
C55B7.12b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C55B7.12b.1:c.637C>T | ||||||||
HGVSp | CE40380:p.Arg213Ter | ||||||||
cDNA_position | 676 | ||||||||
CDS_position | 637 | ||||||||
Protein_position | 213 | ||||||||
Exon_number | 6/8 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Genetics | Interpolated_map_position | I | 1.20504 | ||||||
Description | Phenotype | WBPhenotype:0000249 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | poor osmotic avoidance | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000354 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No ASEL/R differentiation (as seen with lim-6, gcy-7 and gcy-5 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005663 | PATO:0000460 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs6, otIs114,otIs3, ntIs1 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000478 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | normal thermotaxis, poor osmotic avoidance | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001438 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00011915 | ||||||||
WBPaper00006052 | |||||||||
WBPaper00001786 | |||||||||
Method | Substitution_allele |