WormBase Tree Display for Variation: WBVar00095129
expand all nodes | collapse all nodes | view schema
WBVar00095129 | Evidence | Paper_evidence | WBPaper00002980 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | p811 | |||||||
Other_name | R31.3.1:c.31-1G>A | ||||||||
HGVSg | CHROMOSOME_V:g.11927329C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F58H1 | |||||
Flanking_sequences | gttttcgcattttattatttccattttcca | aaccggagtattgggagaaaagttctgatt | |||||||
Mapping_target | F58H1 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002980 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030796 | ||||||||
WBStrain00034401 | |||||||||
Laboratory | PR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003886 | |||||||
Transcript | R31.3.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | R31.3.1:c.31-1G>A | ||||||||
Intron_number | 2/12 | ||||||||
Interactor | WBInteraction000518707 | ||||||||
Genetics | Interpolated_map_position | V | 3.54269 | ||||||
Mapping_data | In_2_point | 371 | |||||||
372 | |||||||||
792 | |||||||||
3383 | |||||||||
In_multi_point | 724 | ||||||||
1174 | |||||||||
2124 | |||||||||
2125 | |||||||||
2126 | |||||||||
2127 | |||||||||
2128 | |||||||||
2129 | |||||||||
In_pos_neg_data | 6115 | ||||||||
6116 | |||||||||
Description | Phenotype | WBPhenotype:0000013 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Daf-d | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000033 | Paper_evidence | WBPaper00051068 | |||||||
Curator_confirmed | WBPerson7188 | ||||||||
Remark | Figure 2. Population density-dependent acceleration of development (Pdda) is increased. | Paper_evidence | WBPaper00051068 | ||||||
Curator_confirmed | WBPerson7188 | ||||||||
WBPhenotype:0000249 | Paper_evidence | WBPaper00000082 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not avoid high concentrations of fructose of NaCl. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
fails to avoid 4M fructose or 4M NaCl | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00002899 | Paper_evidence | WBPaper00000082 | |||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00003571 | Paper_evidence | WBPaper00000082 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000263 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | severely shortened axonemes | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000310 | Paper_evidence | WBPaper00035062 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The ASER neuron lacks ciliary projections in osm-5(p813) and osm-6(p811) IFT mutants | Paper_evidence | WBPaper00035062 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00035062 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | CHE-11:GFP fails to accumulate at the transition zone of osm-5 mutants | Paper_evidence | WBPaper00035062 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | FITC occasionally stains ray sensilla. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000523 | Paper_evidence | WBPaper00038487 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | While N2 animals traveling perpendicular to the NaCl attractant followed a path that curved with a bias toward the attractant, mutant animals did not regulate their turning; however, like wild-type animals curving decreased over time. | Paper_evidence | WBPaper00038487 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00038487 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000615 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Distal and middles segments of all cilia are absent. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000649 | Paper_evidence | WBPaper00003680 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | males are defective in vulva-location behavior | Paper_evidence | WBPaper00003680 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000816 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Ectopic assembly of ciliary structures and microtubules in many sensory neurons. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005759 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000843 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mating efficiency 1; less than 1% of WT mating efficiency. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000932 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | him-5(e1490) | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001084 | Paper_evidence | WBPaper00000932 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not respond to a dilute gradient of NaCl. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
poor chemotaxis to NaCl | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001435 | Paper_evidence | WBPaper00002087 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Chemotaxis frequency 0.02 versus 0.71 for N2. | Paper_evidence | WBPaper00002087 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001438 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Defective in chemotaxis to volatile odorants including benzaldehyde, 2-butanone and isoamyl alcohol (Data not shown). | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001524 | Paper_evidence | WBPaper00035944 | |||||||
Curator_confirmed | WBPerson2776 | ||||||||
WBPerson10038 | |||||||||
Remark | Quoted from the paper: "The quiescence bouts in the nmr-1(ak4);osm-6(p811) mutants were significantly longer than either of the single mutants alone (Figure 2B, Table 1). This additive role of nmr-1 and osm-6 is consistent with two independent pathways of quiescence maintenance." | Paper_evidence | WBPaper00035944 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
WBPhenotype:0001530 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | FITC occasionally stains CEP. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001535 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | FITC occasionally stains ADE or PDE. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001715 | Paper_evidence | WBPaper00038487 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not exhibit any pirouette-mediated reversal bias in response to a food gradient, unlike control animals, which regulated reversals as a function of direction. | Paper_evidence | WBPaper00038487 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002000 | Paper_evidence | WBPaper00038487 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | After exhibiting a greater increase in movement on food (induced by transferring a seeded plate to a multi-worm tracker (MWT) apparatus) than N2, the population of animals also returned to their basal level of spontaneous locomotion speed on food at a faster rate. | Paper_evidence | WBPaper00038487 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002053 | Paper_evidence | WBPaper00055368 | |||||||
Curator_confirmed | WBPerson466 | ||||||||
Remark | survive 10nM ivermectin | Paper_evidence | WBPaper00055368 | ||||||
Curator_confirmed | WBPerson466 | ||||||||
Affected_by | Molecule | WBMol:00002786 | Paper_evidence | WBPaper00055368 | |||||
Curator_confirmed | WBPerson466 | ||||||||
WBPhenotype:0002114 | Paper_evidence | WBPaper00035944 | |||||||
Curator_confirmed | WBPerson2776 | ||||||||
WBPhenotype:0002140 | Paper_evidence | WBPaper00032050 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were defective in response to ascr#3, an ascaroside, that elicited the strongest response for male attraction in control animals. | Paper_evidence | WBPaper00032050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002469 | Paper_evidence | WBPaper00038487 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited an increase in habituation and much smaller reversal distances in response to continued plate taps applied with a 10s interval, compared to N2 animals. | Paper_evidence | WBPaper00038487 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00002087 | |||||||
WBPaper00000932 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Defects in dye filling. | Paper_evidence | WBPaper00002087 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
FITC does not stain amphids or phasmids. | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
fails to take up FITC | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0004004 | Paper_evidence | WBPaper00003680 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | males are response defective | Paper_evidence | WBPaper00003680 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000067 | Paper_evidence | WBPaper00003582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mutants showed a normal feeding inhibition response when exposed to either cadmium or captan | Paper_evidence | WBPaper00003582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000315 | Paper_evidence | WBPaper00000932 | |||||||
WBPaper00000082 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed normal sensitivity to light head and tail tapping with a human eyelash. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00000932 | |||||||
WBPaper00000082 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were able to track isothermally. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
normal thermotaxis | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals moved normally. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001015 | Paper_evidence | WBPaper00000082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not display any major developmental defects compared to N2 animals. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0004027 | Paper_evidence | WBPaper00038487 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit an escape response (reversal) similar to N2 animals upon an initial plate tap. | Paper_evidence | WBPaper00038487 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (21) | |||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
Method | Substitution_allele |