WormBase Tree Display for Variation: WBVar00095129
expand all nodes | collapse all nodes | view schema
WBVar00095129 | Evidence | Paper_evidence | WBPaper00002980 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | F58H1 | |||||
Flanking_sequences | gttttcgcattttattatttccattttcca | aaccggagtattgggagaaaagttctgatt | |||||||
Mapping_target | F58H1 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002980 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030796 | ||||||||
WBStrain00034401 | |||||||||
Laboratory | PR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003886 | |||||||
Transcript | R31.3.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | R31.3.1:c.31-1G>A | ||||||||
Intron_number | 2/12 | ||||||||
Interactor | WBInteraction000518707 | ||||||||
Genetics | Interpolated_map_position | V | 3.54269 | ||||||
Mapping_data | In_2_point | 371 | |||||||
372 | |||||||||
792 | |||||||||
3383 | |||||||||
In_multi_point | 724 | ||||||||
1174 | |||||||||
2124 | |||||||||
2125 | |||||||||
2126 | |||||||||
2127 | |||||||||
2128 | |||||||||
2129 | |||||||||
In_pos_neg_data | 6115 | ||||||||
6116 | |||||||||
Description | Phenotype (26) | ||||||||
Phenotype_not_observed | WBPhenotype:0000067 | Paper_evidence | WBPaper00003582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mutants showed a normal feeding inhibition response when exposed to either cadmium or captan | Paper_evidence | WBPaper00003582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000315 | Paper_evidence | WBPaper00000932 | |||||||
WBPaper00000082 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed normal sensitivity to light head and tail tapping with a human eyelash. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00000932 | |||||||
WBPaper00000082 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were able to track isothermally. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
normal thermotaxis | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals moved normally. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001015 | Paper_evidence | WBPaper00000082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not display any major developmental defects compared to N2 animals. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0004027 | Paper_evidence | WBPaper00038487 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit an escape response (reversal) similar to N2 animals upon an initial plate tap. | Paper_evidence | WBPaper00038487 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (21) | |||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
Method | Substitution_allele |