WormBase Tree Display for Variation: WBVar00095129
expand all nodes | collapse all nodes | view schema
WBVar00095129 | Evidence | Paper_evidence | WBPaper00002980 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | p811 | |||||
Other_name | R31.3.1:c.31-1G>A | ||||||
HGVSg | CHROMOSOME_V:g.11927329C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | F58H1 | |||
Flanking_sequences | gttttcgcattttattatttccattttcca | aaccggagtattgggagaaaagttctgatt | |||||
Mapping_target | F58H1 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002980 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00030796 | ||||||
WBStrain00034401 | |||||||
Laboratory | PR | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003886 | |||||
Transcript | R31.3.1 | VEP_consequence | splice_acceptor_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | R31.3.1:c.31-1G>A | ||||||
Intron_number | 2/12 | ||||||
Interactor | WBInteraction000518707 | ||||||
Genetics | Interpolated_map_position | V | 3.54269 | ||||
Mapping_data | In_2_point | 371 | |||||
372 | |||||||
792 | |||||||
3383 | |||||||
In_multi_point | 724 | ||||||
1174 | |||||||
2124 | |||||||
2125 | |||||||
2126 | |||||||
2127 | |||||||
2128 | |||||||
2129 | |||||||
In_pos_neg_data | 6115 | ||||||
6116 | |||||||
Description | Phenotype (26) | ||||||
Phenotype_not_observed (8) | |||||||
Reference (21) | |||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||
Method | Substitution_allele |