WormBase Tree Display for Variation: WBVar00095132
expand all nodes | collapse all nodes | view schema
WBVar00095132 | Name | Public_name | p821 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F23B2.4.1:c.2262-1G>A | ||||||||
HGVSg | CHROMOSOME_IV:g.9138748C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F23B2 | |||||
Flanking_sequences | tttgaaataccggaaattaatgacttttca | agccatcgaaatatcacataaaatcgatag | |||||||
Mapping_target | F23B2 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00027360 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030799 | ||||||||
Laboratory | PR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000906 | |||||||
Transcript | F23B2.4.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F23B2.4.1:c.2262-1G>A | ||||||||
Intron_number | 13/20 | ||||||||
Interactor | WBInteraction000502223 | ||||||||
Genetics | Interpolated_map_position | IV | 4.05369 | ||||||
Mapping_data | In_2_point | 366 | |||||||
367 | |||||||||
In_multi_point | 1125 | ||||||||
Description | Phenotype | WBPhenotype:0000249 | Paper_evidence | WBPaper00000082 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not avoid high concentrations of fructose of NaCl. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00002899 | Paper_evidence | WBPaper00000082 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00003571 | Paper_evidence | WBPaper00000082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Occasional FITC staining of ray sensilla. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Intermediate response to dauer inducing conditions as assayed through SDS resistance of animals from a crowded, starved plate. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000649 | Paper_evidence | WBPaper00003680 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | males are defective in vulva-location behavior | Paper_evidence | WBPaper00003680 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00028448 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In a stark contrast to wild type, all IFT mutants examined abnormally accumulate PKD-2::GFP in the ciliary base and in the cilium for those mutants with ciliary axonemes. | Paper_evidence | WBPaper00028448 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000843 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mating efficiency 1; <1% of WT mating efficiency. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000932 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | him-5(e1490) | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001530 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Occasional FITC staining of CEP. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001535 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Occasional FITC staining of ADE and PDE. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00002087 | |||||||
WBPaper00000932 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Defects in dye filling. | Paper_evidence | WBPaper00002087 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Frequent weak FITC staining of ADF and ADL but not other amphids or phasmids. | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0004004 | Paper_evidence | WBPaper00003680 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | males are response defective | Paper_evidence | WBPaper00003680 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000315 | Paper_evidence | WBPaper00000932 | ||||||
WBPaper00000082 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed normal sensitivity to light head and tail tapping with a human eyelash. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00000932 | |||||||
WBPaper00000082 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were able to track isothermally. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals moved normally. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001015 | Paper_evidence | WBPaper00000082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not display any major developmental defects compared to N2 animals. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00000932 | ||||||||
WBPaper00028448 | |||||||||
WBPaper00002087 | |||||||||
WBPaper00003680 | |||||||||
WBPaper00000082 | |||||||||
Method | Substitution_allele |