WormBase Tree Display for Variation: WBVar00142906
expand all nodes | collapse all nodes | view schema
WBVar00142906 | Evidence | Paper_evidence | WBPaper00001792 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e8 | |||||||
Other_name (2) | |||||||||
HGVSg | CHROMOSOME_II:g.6715129G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T14B4 | |||||
Flanking_sequences | caaggaccacgtggagttccaggacatcca | gattcccaggtgatccaggagagtatggaa | |||||||
Mapping_target | T14B4 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001792 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (7) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001064 | |||||||
Transcript | T14B4.6.1 (12) | ||||||||
Interactor | WBInteraction000501354 | ||||||||
WBInteraction000501360 | |||||||||
WBInteraction000501366 | |||||||||
WBInteraction000519099 | |||||||||
WBInteraction000519100 | |||||||||
Genetics | Interpolated_map_position | II | 0.0427599 | ||||||
Mapping_data | In_2_point | 47 | |||||||
217 | |||||||||
6101 | |||||||||
In_multi_point (13) | |||||||||
Description | Phenotype | WBPhenotype:0000501 | Paper_evidence | WBPaper00000465 | |||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Weak roller adult. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
dumpy left roller | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 16C, 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00000031 | |||||||
WBPaper00000465 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Weak dumpy L3. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
dumpy left roller; early larvae non-dumpy | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 16C, 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000645 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00058872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | loss of dpy-2 or dpy-9 gene function is associated with increased GFP::DBL-1 fluorescence from texIs100 or texIs101 as shown in (A') and (B'), respectively. dpy-2 and dpy-9 mutants also have reduced spp-9p::gfp reporter activity compared to control (C), as shown in (C') and (C''), respectively. | Paper_evidence | WBPaper00058872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014937 | Paper_evidence | WBPaper00058872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | TLG701 dpy-2(e8); texIs100 | Paper_evidence | WBPaper00058872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00058872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Consistent with the increased GFP::DBL-1 fluorescence at L4, we observed significantly decreased fluorescence from the spp-9p::gfp reporter at L4 (Figure 1, Table 1). T | Paper_evidence | WBPaper00058872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014937 | Paper_evidence | WBPaper00058872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | TLG725 dpy-2(e8); texIs127 | Paper_evidence | WBPaper00058872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Alae are beaded. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001515 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Struts are arranged in somewhat irregular or compressed rows. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001516 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Alae make 1 complete turn along the length of the animal. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Annulae are very deranged. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (12) | |||||||||
Method | Substitution_allele |