WormBase Tree Display for Variation: WBVar00142909
expand all nodes | collapse all nodes | view schema
| WBVar00142909 | Evidence | Paper_evidence | WBPaper00005927 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| WBPaper00006395 | |||||||||
| Name | Public_name | e14 | |||||||
| Other_name | CE30956:p.Trp5Ter | ||||||||
| F16F9.2.1:c.15G>A | |||||||||
| HGVSg | CHROMOSOME_X:g.8455626C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F16F9 | |||||
| Flanking_sequences | agctgttttatttcagatgaggtatgcgtg | gtggtctcgtttgcatttttaatacttgga | |||||||
| Mapping_target | F16F9 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00006395 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain (19) | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001068 | |||||||
| Transcript | F16F9.2.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F16F9.2.1:c.15G>A | ||||||||
| HGVSp | CE30956:p.Trp5Ter | ||||||||
| cDNA_position | 15 | ||||||||
| CDS_position | 15 | ||||||||
| Protein_position | 5 | ||||||||
| Exon_number | 1/9 | ||||||||
| Codon_change | tgG/tgA | ||||||||
| Amino_acid_change | W/* | ||||||||
| Genetics | Interpolated_map_position | X | 0.00141893 | ||||||
| Mapping_data | In_2_point (27) | ||||||||
| In_multi_point | 164 | ||||||||
| 165 | |||||||||
| 166 | |||||||||
| 167 | |||||||||
| 168 | |||||||||
| 169 | |||||||||
| 172 | |||||||||
| 173 | |||||||||
| 176 | |||||||||
| 177 | |||||||||
| 181 | |||||||||
| 314 | |||||||||
| 422 | |||||||||
| 424 | |||||||||
| 531 | |||||||||
| 791 | |||||||||
| 792 | |||||||||
| 880 | |||||||||
| 1195 | |||||||||
| 1196 | |||||||||
| 1202 | |||||||||
| 1203 | |||||||||
| 1205 | |||||||||
| 1214 | |||||||||
| 1218 | |||||||||
| 1327 | |||||||||
| 1329 | |||||||||
| 1330 | |||||||||
| 1334 | |||||||||
| 1336 | |||||||||
| 1337 | |||||||||
| 1341 | |||||||||
| 1439 | |||||||||
| 1539 | |||||||||
| 1583 | |||||||||
| 1589 | |||||||||
| 1638 | |||||||||
| 1738 | |||||||||
| 1740 | |||||||||
| 1741 | |||||||||
| 1742 | |||||||||
| 1771 | |||||||||
| 1776 | |||||||||
| 2059 | |||||||||
| 2066 | |||||||||
| 2211 | |||||||||
| 2215 | |||||||||
| 2259 | |||||||||
| 2261 | |||||||||
| 2262 | |||||||||
| 2273 | |||||||||
| 2274 | |||||||||
| 2471 | |||||||||
| 3080 | |||||||||
| 3084 | |||||||||
| 3085 | |||||||||
| 3087 | |||||||||
| 3088 | |||||||||
| 3089 | |||||||||
| 3090 | |||||||||
| 3091 | |||||||||
| 3092 | |||||||||
| 3244 | |||||||||
| 3273 | |||||||||
| 3286 | |||||||||
| 3295 | |||||||||
| 3378 | |||||||||
| In_pos_neg_data | 657 | ||||||||
| 1840 | |||||||||
| 1844 | |||||||||
| 1854 | |||||||||
| 1893 | |||||||||
| 1917 | |||||||||
| 1933 | |||||||||
| 1949 | |||||||||
| 1965 | |||||||||
| 1981 | |||||||||
| 1997 | |||||||||
| 2004 | |||||||||
| 2013 | |||||||||
| 2029 | |||||||||
| 2045 | |||||||||
| 2363 | |||||||||
| 7299 | |||||||||
| 7300 | |||||||||
| 7301 | |||||||||
| Description | Phenotype | WBPhenotype:0000229 | Paper_evidence | WBPaper00005927 | |||||
| Curator_confirmed | WBPerson48 | ||||||||
| WBPhenotype:0000583 | Paper_evidence | WBPaper00005927 | |||||||
| WBPaper00000031 | |||||||||
| Person_evidence | WBPerson261 | ||||||||
| Curator_confirmed | WBPerson48 | ||||||||
| WBPerson712 | |||||||||
| Remark | small dumpy, non-roller. ES3 ME0 | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000645 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | non-roller | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000718 | Paper_evidence | WBPaper00001011 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals have 85%(n=20) mutant seam cell nuclei, similar to XX lin-14 animals (77% n=40). | Paper_evidence | WBPaper00001011 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | Animals were raised at 24C. | Paper_evidence | WBPaper00001011 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Temperature | 24 | Paper_evidence | WBPaper00001011 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | lin-14(n179) | Paper_evidence | WBPaper00001011 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference (11) | |||||||||
| Method | Substitution_allele |
