WormBase Tree Display for Variation: WBVar00142909
expand all nodes | collapse all nodes | view schema
WBVar00142909 | Evidence | Paper_evidence | WBPaper00005927 | |||||
---|---|---|---|---|---|---|---|---|
WBPaper00006395 | ||||||||
Name | Public_name | e14 | ||||||
Other_name | CE30956:p.Trp5Ter | |||||||
F16F9.2.1:c.15G>A | ||||||||
HGVSg | CHROMOSOME_X:g.8455626C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F16F9 | ||||
Flanking_sequences | agctgttttatttcagatgaggtatgcgtg | gtggtctcgtttgcatttttaatacttgga | ||||||
Mapping_target | F16F9 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00006395 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (19) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001068 | ||||||
Transcript | F16F9.2.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | F16F9.2.1:c.15G>A | |||||||
HGVSp | CE30956:p.Trp5Ter | |||||||
cDNA_position | 15 | |||||||
CDS_position | 15 | |||||||
Protein_position | 5 | |||||||
Exon_number | 1/9 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
Genetics | Interpolated_map_position | X | 0.00141893 | |||||
Mapping_data | In_2_point (27) | |||||||
In_multi_point (67) | ||||||||
In_pos_neg_data | 657 | |||||||
1840 | ||||||||
1844 | ||||||||
1854 | ||||||||
1893 | ||||||||
1917 | ||||||||
1933 | ||||||||
1949 | ||||||||
1965 | ||||||||
1981 | ||||||||
1997 | ||||||||
2004 | ||||||||
2013 | ||||||||
2029 | ||||||||
2045 | ||||||||
2363 | ||||||||
7299 | ||||||||
7300 | ||||||||
7301 | ||||||||
Description | Phenotype | WBPhenotype:0000229 | Paper_evidence | WBPaper00005927 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00005927 | ||||||
WBPaper00000031 | ||||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
Remark | small dumpy, non-roller. ES3 ME0 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations (2) | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000645 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | non-roller | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000718 | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals have 85%(n=20) mutant seam cell nuclei, similar to XX lin-14 animals (77% n=40). | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were raised at 24C. | Paper_evidence | WBPaper00001011 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 24 | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | lin-14(n179) | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference (11) | ||||||||
Method | Substitution_allele |