WormBase Tree Display for Variation: WBVar00142909
expand all nodes | collapse all nodes | view schema
WBVar00142909 | Evidence | Paper_evidence | WBPaper00005927 | ||||||
---|---|---|---|---|---|---|---|---|---|
WBPaper00006395 | |||||||||
Name | Public_name | e14 | |||||||
Other_name (2) | |||||||||
HGVSg | CHROMOSOME_X:g.8455626C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F16F9 | |||||
Flanking_sequences | agctgttttatttcagatgaggtatgcgtg | gtggtctcgtttgcatttttaatacttgga | |||||||
Mapping_target | F16F9 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00006395 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (19) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001068 | |||||||
Transcript | F16F9.2.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F16F9.2.1:c.15G>A | ||||||||
HGVSp | CE30956:p.Trp5Ter | ||||||||
cDNA_position | 15 | ||||||||
CDS_position | 15 | ||||||||
Protein_position | 5 | ||||||||
Exon_number | 1/9 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
Genetics | Interpolated_map_position | X | 0.00141893 | ||||||
Mapping_data (3) | |||||||||
Description | Phenotype | WBPhenotype:0000229 | Paper_evidence | WBPaper00005927 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00005927 | |||||||
WBPaper00000031 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | small dumpy, non-roller. ES3 ME0 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000645 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | non-roller | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000718 | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals have 85%(n=20) mutant seam cell nuclei, similar to XX lin-14 animals (77% n=40). | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were raised at 24C. | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | lin-14(n179) | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (11) | |||||||||
Method | Substitution_allele |