WormBase Tree Display for Variation: WBVar00142924
expand all nodes | collapse all nodes | view schema
| WBVar00142924 | Evidence | Paper_evidence | WBPaper00025184 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e30 | |||||||
| Other_name (12) | |||||||||
| HGVSg | CHROMOSOME_V:g.11908351G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | R31 | |||||
| Flanking_sequences | caagaagcaggaagcactcagaaccgcatg | aacacactgtgtgaatacatcgaagcacgt | |||||||
| Mapping_target | R31 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00025184 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin (4) | |||||||||
| Affects | Gene | WBGene00004855 | |||||||
| Transcript | R31.1e.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | R31.1e.1:c.5889G>A | ||||||||
| HGVSp | CE52987:p.Trp1963Ter | ||||||||
| cDNA_position | 5889 | ||||||||
| CDS_position | 5889 | ||||||||
| Protein_position | 1963 | ||||||||
| Exon_number | 8/17 | ||||||||
| Codon_change | tgG/tgA | ||||||||
| Amino_acid_change | W/* | ||||||||
| R31.1a.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | R31.1a.1:c.5889G>A | ||||||||
| HGVSp | CE41581:p.Trp1963Ter | ||||||||
| cDNA_position | 6004 | ||||||||
| CDS_position | 5889 | ||||||||
| Protein_position | 1963 | ||||||||
| Exon_number | 9/20 | ||||||||
| Codon_change | tgG/tgA | ||||||||
| Amino_acid_change | W/* | ||||||||
| R31.1c.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | R31.1c.1:c.5331G>A | ||||||||
| HGVSp | CE46009:p.Trp1777Ter | ||||||||
| cDNA_position | 5331 | ||||||||
| CDS_position | 5331 | ||||||||
| Protein_position | 1777 | ||||||||
| Exon_number | 5/15 | ||||||||
| Codon_change | tgG/tgA | ||||||||
| Amino_acid_change | W/* | ||||||||
| R31.1b.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | R31.1b.1:c.5580G>A | ||||||||
| HGVSp | CE27773:p.Trp1860Ter | ||||||||
| cDNA_position | 5580 | ||||||||
| CDS_position | 5580 | ||||||||
| Protein_position | 1860 | ||||||||
| Exon_number | 7/17 | ||||||||
| Codon_change | tgG/tgA | ||||||||
| Amino_acid_change | W/* | ||||||||
| R31.1d.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | R31.1d.1:c.5580G>A | ||||||||
| HGVSp | CE46252:p.Trp1860Ter | ||||||||
| cDNA_position | 5822 | ||||||||
| CDS_position | 5580 | ||||||||
| Protein_position | 1860 | ||||||||
| Exon_number | 8/18 | ||||||||
| Codon_change | tgG/tgA | ||||||||
| Amino_acid_change | W/* | ||||||||
| R31.1f.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | R31.1f.1:c.5331G>A | ||||||||
| HGVSp | CE53064:p.Trp1777Ter | ||||||||
| cDNA_position | 5331 | ||||||||
| CDS_position | 5331 | ||||||||
| Protein_position | 1777 | ||||||||
| Exon_number | 5/14 | ||||||||
| Codon_change | tgG/tgA | ||||||||
| Amino_acid_change | W/* | ||||||||
| Interactor | WBInteraction000500863 | ||||||||
| Genetics | Interpolated_map_position | V | 3.53978 | ||||||
| Mapping_data | In_2_point (12) | ||||||||
| In_multi_point | 145 | ||||||||
| 146 | |||||||||
| 262 | |||||||||
| 263 | |||||||||
| 342 | |||||||||
| 480 | |||||||||
| 542 | |||||||||
| 543 | |||||||||
| 544 | |||||||||
| 545 | |||||||||
| 605 | |||||||||
| 608 | |||||||||
| 614 | |||||||||
| 656 | |||||||||
| 663 | |||||||||
| 665 | |||||||||
| 781 | |||||||||
| 784 | |||||||||
| 787 | |||||||||
| 797 | |||||||||
| 941 | |||||||||
| 945 | |||||||||
| 946 | |||||||||
| 947 | |||||||||
| 948 | |||||||||
| 950 | |||||||||
| 952 | |||||||||
| 1141 | |||||||||
| 1142 | |||||||||
| 1168 | |||||||||
| 1172 | |||||||||
| 1173 | |||||||||
| 1174 | |||||||||
| 1175 | |||||||||
| 1176 | |||||||||
| 1177 | |||||||||
| 1178 | |||||||||
| 1181 | |||||||||
| 1183 | |||||||||
| 1186 | |||||||||
| 1191 | |||||||||
| 1317 | |||||||||
| 1918 | |||||||||
| 2015 | |||||||||
| 2125 | |||||||||
| 2126 | |||||||||
| 2127 | |||||||||
| 2129 | |||||||||
| 2132 | |||||||||
| 2133 | |||||||||
| 2135 | |||||||||
| 2138 | |||||||||
| 2263 | |||||||||
| 2269 | |||||||||
| 2413 | |||||||||
| 2414 | |||||||||
| 2416 | |||||||||
| 2421 | |||||||||
| 2798 | |||||||||
| 2817 | |||||||||
| 3064 | |||||||||
| 3065 | |||||||||
| 3069 | |||||||||
| 3070 | |||||||||
| 3071 | |||||||||
| 3072 | |||||||||
| 3074 | |||||||||
| 3075 | |||||||||
| 3077 | |||||||||
| 3083 | |||||||||
| 3101 | |||||||||
| 3104 | |||||||||
| 3142 | |||||||||
| 3146 | |||||||||
| In_pos_neg_data | 296 | ||||||||
| 852 | |||||||||
| 867 | |||||||||
| 1742 | |||||||||
| 1754 | |||||||||
| 1815 | |||||||||
| 2130 | |||||||||
| 3408 | |||||||||
| 6770 | |||||||||
| 6869 | |||||||||
| Description | Phenotype | WBPhenotype:0000071 | Paper_evidence | WBPaper00000031 | |||||
| Curator_confirmed | WBPerson48 | ||||||||
| Remark | larvae have shortened, round heads | Paper_evidence | WBPaper00000031 | ||||||
| Curator_confirmed | WBPerson48 | ||||||||
| WBPhenotype:0000229 | Paper_evidence | WBPaper00000031 | |||||||
| WBPaper00038069 | |||||||||
| WBPaper00003094 | |||||||||
| Curator_confirmed | WBPerson48 | ||||||||
| WBPerson712 | |||||||||
| WBPerson415 | |||||||||
| Remark | Double mutants of show additive effects. | Paper_evidence | WBPaper00038069 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000322 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | round-headed, especially in early larvae | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000324 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | short, especially in early larvae | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000469 | Paper_evidence | WBPaper00061063 | |||||||
| Curator_confirmed | WBPerson172 | ||||||||
| Remark | Fig 2B | Paper_evidence | WBPaper00061063 | ||||||
| Curator_confirmed | WBPerson172 | ||||||||
| WBPhenotype:0000645 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | adults have slight rolling tendency | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000901 | Paper_evidence | WBPaper00040002 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | animals exhibited the same defects observed in iv38 homozygotes | Paper_evidence | WBPaper00040002 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005788 | PATO:0000460 | Paper_evidence | WBPaper00040002 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00040002 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_not_observed | WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference (15) | |||||||||
| Method | Substitution_allele |
