WormBase Tree Display for Variation: WBVar00142935
expand all nodes | collapse all nodes | view schema
WBVar00142935 | Name | Public_name | e51 | ||||
---|---|---|---|---|---|---|---|
Other_name (18) | |||||||
HGVSg | CHROMOSOME_I:g.7434408C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | C44E1 | |||
Flanking_sequences | AAGATGACACTCACCAATATGATGAAGTTGATCGTGGATCC | GAGTATCTTTCACAAGAACACCATCAGTAGATAGAACAG | |||||
Mapping_target | C44E1 | ||||||
Type_of_mutation | Substitution | C | T | Person_evidence | WBPerson26471 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Engineered_allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (64) | |||||||
Laboratory | CB | ||||||
KR | |||||||
NCA | |||||||
Person | WBPerson26471 | ||||||
Status | Live | ||||||
Linked_to | WBVar02146566 | ||||||
Affects (3) | |||||||
Isolation | Mutagen | EMS | |||||
Genetics | Interpolated_map_position | I | 2.07389 | ||||
Mapping_data | In_2_point (20) | ||||||
In_multi_point (87) | |||||||
In_pos_neg_data | 466 | ||||||
470 | |||||||
2514 | |||||||
5851 | |||||||
5853 | |||||||
5963 | |||||||
8066 | |||||||
8086 | |||||||
Description (2) | |||||||
Reference (29) | |||||||
Remark | Old Mapping_target ZK524 updated based on the VEP analysis pipeline to C44E1. | ||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006752 Opal_UGA R to STOP | Person_evidence | WBPerson26471" | |||||
WBPerson26471 | |||||||
Method | Substitution_allele |