WormBase Tree Display for Variation: WBVar00142935

WBVar00142935 Name: Public_name: e51
    Other_name (18)
    HGVSg: CHROMOSOME_I:g.7434408C>T
  Sequence_details: SMap: S_parent: Sequence: C44E1
    Flanking_sequences: AAGATGACACTCACCAATATGATGAAGTTGATCGTGGATCC GAGTATCTTTCACAAGAACACCATCAGTAGATAGAACAG
    Mapping_target: C44E1
    Type_of_mutation: Substitution: C T Person_evidence: WBPerson26471
    SeqStatus: Sequenced
  Variation_type: Engineered_allele
  Origin: Species: Caenorhabditis elegans
    Strain (64)
    Laboratory: CB
      KR
      NCA
    Person: WBPerson26471
    Status: Live
  Linked_to: WBVar02146566
  Affects (3)
  Isolation: Mutagen: EMS
  Genetics: Interpolated_map_position: I 2.07389
    Mapping_data (3)
  Description: Phenotype (13)
    Phenotype_not_observed: WBPhenotype:0000640 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: able to lay eggs Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0001426 Paper_evidence: WBPaper00030754
          WBPaper00004883
        Curator_confirmed: WBPerson712
        Remark: as measured by fluorescence levels of ANF::GFP in coelomocytes Paper_evidence: WBPaper00030754
            Curator_confirmed: WBPerson712
        Variation_effect: Hypomorph_reduction_of_function: Paper_evidence: WBPaper00004883
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: EG3683 unc-13(e51) oxIs206[Paex-3:ANF::GFP] Paper_evidence: WBPaper00030754
              Curator_confirmed: WBPerson712
            arIs37 Paper_evidence: WBPaper00004883
              Curator_confirmed: WBPerson712
      WBPhenotype:0001512 Paper_evidence: WBPaper00031992
        Curator_confirmed: WBPerson712
        Remark: ON-OFF asymmetry of ASEL and ASER was preserved in each of these animals. Paper_evidence: WBPaper00031992
            Curator_confirmed: WBPerson712
      WBPhenotype:0001645 Paper_evidence: WBPaper00040284
        Curator_confirmed: WBPerson2987
        Remark: Table S2 Paper_evidence: WBPaper00040284
            Curator_confirmed: WBPerson2987
  Reference (29)
  Remark: Old Mapping_target ZK524 updated based on the VEP analysis pipeline to C44E1.
    Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006752 Opal_UGA R to STOP Person_evidence: WBPerson26471"
        WBPerson26471
  Method: Substitution_allele