WormBase Tree Display for Variation: WBVar00142935
expand all nodes | collapse all nodes | view schema
WBVar00142935 | Name | Public_name | e51 | ||||
---|---|---|---|---|---|---|---|
Other_name (18) | |||||||
HGVSg | CHROMOSOME_I:g.7434408C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | C44E1 | |||
Flanking_sequences | AAGATGACACTCACCAATATGATGAAGTTGATCGTGGATCC | GAGTATCTTTCACAAGAACACCATCAGTAGATAGAACAG | |||||
Mapping_target | C44E1 | ||||||
Type_of_mutation | Substitution | C | T | Person_evidence | WBPerson26471 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Engineered_allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (64) | |||||||
Laboratory | CB | ||||||
KR | |||||||
NCA | |||||||
Person | WBPerson26471 | ||||||
Status | Live | ||||||
Linked_to | WBVar02146566 | ||||||
Affects | Gene | WBGene00006752 | |||||
Transcript | ZK524.2e.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | ZK524.2e.1:c.1411C>T | ||||||
HGVSp | CE34626:p.Arg471Ter | ||||||
cDNA_position | 1411 | ||||||
CDS_position | 1411 | ||||||
Protein_position | 471 | ||||||
Exon_number | 11/30 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
ZK524.2c.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK524.2c.1:c.388C>T | ||||||
HGVSp | CE34624:p.Arg130Ter | ||||||
cDNA_position | 388 | ||||||
CDS_position | 388 | ||||||
Protein_position | 130 | ||||||
Exon_number | 3/22 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
ZK524.2f.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK524.2f.1:c.1420C>T | ||||||
HGVSp | CE43866:p.Arg474Ter | ||||||
cDNA_position | 1420 | ||||||
CDS_position | 1420 | ||||||
Protein_position | 474 | ||||||
Exon_number | 11/30 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
ZK524.2j.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK524.2j.1:c.1375C>T | ||||||
HGVSp | CE51718:p.Arg459Ter | ||||||
cDNA_position | 1375 | ||||||
CDS_position | 1375 | ||||||
Protein_position | 459 | ||||||
Exon_number | 11/29 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
ZK524.2k.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK524.2k.1:c.1366C>T | ||||||
HGVSp | CE51726:p.Arg456Ter | ||||||
cDNA_position | 1366 | ||||||
CDS_position | 1366 | ||||||
Protein_position | 456 | ||||||
Exon_number | 11/29 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
ZK524.2a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK524.2a.1:c.1411C>T | ||||||
HGVSp | CE15371:p.Arg471Ter | ||||||
cDNA_position | 1411 | ||||||
CDS_position | 1411 | ||||||
Protein_position | 471 | ||||||
Exon_number | 11/30 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
ZK524.2i.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK524.2i.1:c.1420C>T | ||||||
HGVSp | CE32552:p.Arg474Ter | ||||||
cDNA_position | 1420 | ||||||
CDS_position | 1420 | ||||||
Protein_position | 474 | ||||||
Exon_number | 11/29 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
ZK524.2d.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK524.2d.1:c.1411C>T | ||||||
HGVSp | CE34625:p.Arg471Ter | ||||||
cDNA_position | 1411 | ||||||
CDS_position | 1411 | ||||||
Protein_position | 471 | ||||||
Exon_number | 11/31 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
ZK524.2h.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK524.2h.1:c.388C>T | ||||||
HGVSp | CE51759:p.Arg130Ter | ||||||
cDNA_position | 388 | ||||||
CDS_position | 388 | ||||||
Protein_position | 130 | ||||||
Exon_number | 3/21 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
Interactor | WBInteraction000518950 | ||||||
Isolation | Mutagen | EMS | |||||
Genetics | Interpolated_map_position | I | 2.07389 | ||||
Mapping_data | In_2_point (20) | ||||||
In_multi_point (87) | |||||||
In_pos_neg_data | 466 | ||||||
470 | |||||||
2514 | |||||||
5851 | |||||||
5853 | |||||||
5963 | |||||||
8066 | |||||||
8086 | |||||||
Description | Phenotype (13) | ||||||
Phenotype_not_observed | WBPhenotype:0000640 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | able to lay eggs | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00030754 | |||||
WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||
Remark | as measured by fluorescence levels of ANF::GFP in coelomocytes | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_assay | Genotype (2) | ||||||
WBPhenotype:0001512 | Paper_evidence | WBPaper00031992 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | ON-OFF asymmetry of ASEL and ASER was preserved in each of these animals. | Paper_evidence | WBPaper00031992 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Reference (29) | |||||||
Remark (2) | |||||||
Method | Substitution_allele |