WormBase Tree Display for Variation: WBVar00142948
expand all nodes | collapse all nodes | view schema
WBVar00142948 | Evidence | Paper_evidence | WBPaper00001431 | ||||||
---|---|---|---|---|---|---|---|---|---|
Person_evidence | WBPerson267 | ||||||||
Name | Public_name | e73 | |||||||
Other_name | CE09197:p.Glu342Lys | ||||||||
F07A5.7a.2:c.1024G>A | |||||||||
F07A5.7b.1:c.67G>A | |||||||||
F07A5.7a.1:c.1024G>A | |||||||||
CE42754:p.Glu23Lys | |||||||||
HGVSg | CHROMOSOME_I:g.7379262C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F07A5 | |||||
Flanking_sequences | gagatcatgctccagaagatttctcaactc | agaaggccaagtctcgtcttcaatctgagg | |||||||
Mapping_target | F07A5 | ||||||||
Type_of_mutation | Substitution | G | A | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (35) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006754 | |||||||
Transcript | F07A5.7a.1 (12) | ||||||||
F07A5.7a.2 (12) | |||||||||
F07A5.7b.1 (12) | |||||||||
Interactor | WBInteraction000518394 | ||||||||
WBInteraction000518614 | |||||||||
WBInteraction000518905 | |||||||||
Isolation | Mutagen | EMS | |||||||
Forward_genetics | standard phenotypic screen | ||||||||
Genetics | Interpolated_map_position | I | 2.05567 | ||||||
Mapping_data | In_2_point | 13 | |||||||
238 | |||||||||
516 | |||||||||
1017 | |||||||||
In_multi_point | 3 | ||||||||
10 | |||||||||
20 | |||||||||
21 | |||||||||
22 | |||||||||
23 | |||||||||
24 | |||||||||
27 | |||||||||
242 | |||||||||
344 | |||||||||
436 | |||||||||
453 | |||||||||
1825 | |||||||||
1889 | |||||||||
In_pos_neg_data | 515 | ||||||||
2518 | |||||||||
4992 | |||||||||
4999 | |||||||||
5003 | |||||||||
5345 | |||||||||
Description | Phenotype | WBPhenotype:0000349 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | limp paralysed phenotype | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000509 | Paper_evidence | WBPaper00000536 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Only 3.1% of the sperm have pseudopods, a few of which are smooth. | Paper_evidence | WBPaper00000536 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006798 | PATO:0000460 | Paper_evidence | WBPaper00000536 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000640 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Egl | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000644 | Paper_evidence | WBPaper00000031 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | limp paralysed phenotype, larvae move slightly better | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | e73/+ slightly slow | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Dominant | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000782 | Paper_evidence | WBPaper00027179 | |||||||
Curator_confirmed | WBPerson5 | ||||||||
WBPhenotype:0000861 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | defect in body muscle cells | Paper_evidence | WBPaper00000031 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000926 | Paper_evidence | WBPaper00000031 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | defect in body muscle cells | Paper_evidence | WBPaper00000031 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
disorganized muscle structure | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001292 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | defect in body muscle cells | Paper_evidence | WBPaper00000031 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001889 | Paper_evidence | WBPaper00027179 | |||||||
Curator_confirmed | WBPerson5 | ||||||||
Reference | WBPaper00016541 | ||||||||
WBPaper00016542 | |||||||||
WBPaper00000031 | |||||||||
WBPaper00015829 | |||||||||
WBPaper00015529 | |||||||||
WBPaper00000536 | |||||||||
WBPaper00015915 | |||||||||
WBPaper00016343 | |||||||||
WBPaper00016454 | |||||||||
WBPaper00016578 | |||||||||
WBPaper00015926 | |||||||||
WBPaper00012600 | |||||||||
WBPaper00012674 | |||||||||
WBPaper00021833 | |||||||||
WBPaper00022376 | |||||||||
WBPaper00013649 | |||||||||
WBPaper00013682 | |||||||||
WBPaper00016086 | |||||||||
WBPaper00016155 | |||||||||
WBPaper00001782 | |||||||||
WBPaper00012617 | |||||||||
WBPaper00011913 | |||||||||
WBPaper00014041 | |||||||||
WBPaper00014106 | |||||||||
WBPaper00020841 | |||||||||
WBPaper00013745 | |||||||||
WBPaper00018459 | |||||||||
WBPaper00025391 | |||||||||
WBPaper00015996 | |||||||||
WBPaper00023238 | |||||||||
WBPaper00027179 | |||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006754 Missense 342 E to K | ||||||||
Method | Substitution_allele |