WormBase Tree Display for Variation: WBVar00142951
expand all nodes | collapse all nodes | view schema
WBVar00142951 | Evidence | Paper_evidence | WBPaper00003560 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e81 | |||||||
Other_name | CE24927:p.Gln520Ter | ||||||||
F27D9.1a.1:c.1558C>T | |||||||||
HGVSg | CHROMOSOME_X:g.7685018C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C53C9 | |||||
Flanking_sequences | ttcagagcccctgcatctgctagatatggt | agtggcacaaggaacgaggacaacaatcca | |||||||
Mapping_target | C53C9 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003560 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004094 | ||||||||
WBStrain00007165 | |||||||||
WBStrain00026732 | |||||||||
WBStrain00026853 | |||||||||
WBStrain00030690 | |||||||||
WBStrain00033537 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006757 | |||||||
Transcript | F27D9.1a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F27D9.1a.1:c.1558C>T | ||||||||
HGVSp | CE24927:p.Gln520Ter | ||||||||
cDNA_position | 1594 | ||||||||
CDS_position | 1558 | ||||||||
Protein_position | 520 | ||||||||
Exon_number | 10/11 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000503689 | ||||||||
WBInteraction000504904 | |||||||||
WBInteraction000517392 | |||||||||
WBInteraction000518362 | |||||||||
Genetics | Interpolated_map_position | X | -1.34794 | ||||||
Mapping_data (3) | |||||||||
Description | Phenotype (27) | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson6467 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000640 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | able to lay eggs | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00050142 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In contrast, mutations that block small molecule neurosecretion, unc-13(e1091) or unc-18(e81), had no effect on the mitochondrial stress response to polyQ40 expression in the nervous system (Figure 4A)." | Paper_evidence | WBPaper00050142 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0034514 | PATO:0000460 | Paper_evidence | WBPaper00050142 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | rmIs101 [rgef-1p::Q40::YFP]; zcIs13 [hsp-6p::GFP] | Paper_evidence | WBPaper00050142 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (16) | |||||||||
Remark | Sequencing of the CB81 strain indicates that this mutation is a Q520stop, not Q530stop as described in the paper. | Person_evidence | WBPerson6467 | ||||||
Method | Substitution_allele |