WormBase Tree Display for Variation: WBVar00142954
expand all nodes | collapse all nodes | view schema
WBVar00142954 | Evidence | Paper_evidence | WBPaper00044340 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e91 | |||||
Other_name | Y57A10A.11.1:c.238C>T | ||||||
CE22614:p.Arg80Cys | |||||||
HGVSg | CHROMOSOME_II:g.12173668C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | Y57A10A | |||
Flanking_sequences | tcatttacacgtggattcaaccgtaccgcc | gtcaagctggctacgagtactcgaatgatg | |||||
Mapping_target | Y57A10A | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00044340 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (20) | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00004394 | |||||
Transcript | Y57A10A.11.1 (12) | ||||||
Interactor | WBInteraction000052484 | ||||||
WBInteraction000052497 | |||||||
WBInteraction000052504 | |||||||
WBInteraction000052505 | |||||||
WBInteraction000052506 | |||||||
WBInteraction000052507 | |||||||
WBInteraction000052508 | |||||||
WBInteraction000052509 | |||||||
Genetics | Interpolated_map_position | II | 6.89249 | ||||
Mapping_data | In_2_point | 39 | |||||
44 | |||||||
271 | |||||||
1535 | |||||||
6102 | |||||||
6154 | |||||||
In_multi_point (22) | |||||||
In_pos_neg_data | 1542 | ||||||
1553 | |||||||
2141 | |||||||
Marked_rearrangement | mIn1[rol-1(e91) dpy-10(e128)] | ||||||
mIn1[rol-1(e91)] | |||||||
Description (2) | |||||||
Reference (15) | |||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||
Method | Substitution_allele |