WormBase Tree Display for Variation: WBVar00142960
expand all nodes | collapse all nodes | view schema
WBVar00142960 | Evidence | Person_evidence | WBPerson21026 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e101 | |||||
Other_name | R12H7.1a.2:c.1039-1G>A | ||||||
R12H7.1a.1:c.1039-1G>A | |||||||
R12H7.1b.1:c.847-1G>A | |||||||
HGVSg | CHROMOSOME_X:g.13215704G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | R12H7 | |||
Flanking_sequences | ttacactgaccgaaattaaaccccatttca | gatggtgttttcctacttcgtatggttgca | |||||
Mapping_target | R12H7 | ||||||
Type_of_mutation | Substitution | g | a | Person_evidence | WBPerson21026 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (19) | |||||||
Laboratory | CB | ||||||
OJ | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00006749 | |||||
Transcript | R12H7.1a.2 | VEP_consequence | splice_acceptor_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | R12H7.1a.2:c.1039-1G>A | ||||||
Intron_number | 9/10 | ||||||
R12H7.1a.1 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | R12H7.1a.1:c.1039-1G>A | ||||||
Intron_number | 8/9 | ||||||
R12H7.1b.1 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | R12H7.1b.1:c.847-1G>A | ||||||
Intron_number | 5/5 | ||||||
Interactor | WBInteraction000052321 | ||||||
WBInteraction000052323 | |||||||
WBInteraction000052325 | |||||||
WBInteraction000518927 | |||||||
WBInteraction000518931 | |||||||
Isolation | Mutagen | EMS | |||||
Genetics | Interpolated_map_position | X | 10.3258 | ||||
Mapping_data | In_2_point (11) | ||||||
In_multi_point (35) | |||||||
In_pos_neg_data (19) | |||||||
Description | Phenotype (25) | ||||||
Phenotype_not_observed | WBPhenotype:0001611 | Paper_evidence | WBPaper00000958 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals exhibit normal halothane sensitivity. | Paper_evidence | WBPaper00000958 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001612 | Paper_evidence | WBPaper00002358 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals have a similar EC50 (1020 30mM) compared to N2 (1050 25 mM). | Paper_evidence | WBPaper00002358 | ||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_assay (2) | |||||||
Reference (9) | |||||||
Method | Substitution_allele |