WormBase Tree Display for Variation: WBVar00142975
expand all nodes | collapse all nodes | view schema
WBVar00142975 | Evidence | Paper_evidence | WBPaper00003757 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e120 | ||||||
Other_name | F26C11.2.1:c.597+1G>A | |||||||
HGVSg | CHROMOSOME_II:g.9898071C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F26C11 | ||||
Flanking_sequences | cgaccaaatgcgaaatatcccagggttcag | taatttgtttcgtatagtttttcgacaaatt | ||||||
Mapping_target | F26C11 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (254) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006744 | ||||||
Transcript | F26C11.2.1 | VEP_consequence | splice_donor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F26C11.2.1:c.597+1G>A | |||||||
Intron_number | 6/7 | |||||||
Interactor (16) | ||||||||
Genetics | Interpolated_map_position | II | 1.76951 | |||||
Mapping_data | In_2_point | 36 | ||||||
38 | ||||||||
41 | ||||||||
48 | ||||||||
216 | ||||||||
218 | ||||||||
219 | ||||||||
250 | ||||||||
270 | ||||||||
324 | ||||||||
325 | ||||||||
326 | ||||||||
338 | ||||||||
339 | ||||||||
340 | ||||||||
341 | ||||||||
342 | ||||||||
343 | ||||||||
344 | ||||||||
345 | ||||||||
346 | ||||||||
575 | ||||||||
577 | ||||||||
583 | ||||||||
626 | ||||||||
649 | ||||||||
653 | ||||||||
735 | ||||||||
773 | ||||||||
776 | ||||||||
781 | ||||||||
789 | ||||||||
945 | ||||||||
1520 | ||||||||
1521 | ||||||||
1522 | ||||||||
1523 | ||||||||
1534 | ||||||||
1538 | ||||||||
2630 | ||||||||
2631 | ||||||||
3226 | ||||||||
3680 | ||||||||
4988 | ||||||||
6017 | ||||||||
6022 | ||||||||
6099 | ||||||||
6100 | ||||||||
6168 | ||||||||
In_multi_point (159) | ||||||||
In_pos_neg_data (22) | ||||||||
Marked_rearrangement | mIn1[unc-4(e120) dpy-10(e128)] | |||||||
mIn1[unc-4(e120)] | ||||||||
Description | Phenotype (24) | |||||||
Phenotype_not_observed | WBPhenotype:0000641 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Healthy, active. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Reference (54) | ||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006744 Donor | |||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Method | Substitution_allele |