WormBase Tree Display for Variation: WBVar00142975
expand all nodes | collapse all nodes | view schema
WBVar00142975 | Evidence | Paper_evidence | WBPaper00003757 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e120 | ||||||
Other_name | F26C11.2.1:c.597+1G>A | |||||||
HGVSg | CHROMOSOME_II:g.9898071C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F26C11 | ||||
Flanking_sequences | cgaccaaatgcgaaatatcccagggttcag | taatttgtttcgtatagtttttcgacaaatt | ||||||
Mapping_target | F26C11 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (254) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006744 | ||||||
Transcript | F26C11.2.1 | VEP_consequence | splice_donor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F26C11.2.1:c.597+1G>A | |||||||
Intron_number | 6/7 | |||||||
Interactor (16) | ||||||||
Genetics | Interpolated_map_position | II | 1.76951 | |||||
Mapping_data | In_2_point (49) | |||||||
In_multi_point | 41 | |||||||
45 | ||||||||
47 | ||||||||
48 | ||||||||
50 | ||||||||
51 | ||||||||
53 | ||||||||
55 | ||||||||
56 | ||||||||
206 | ||||||||
207 | ||||||||
252 | ||||||||
253 | ||||||||
274 | ||||||||
307 | ||||||||
413 | ||||||||
467 | ||||||||
468 | ||||||||
470 | ||||||||
475 | ||||||||
485 | ||||||||
519 | ||||||||
521 | ||||||||
528 | ||||||||
529 | ||||||||
537 | ||||||||
548 | ||||||||
549 | ||||||||
564 | ||||||||
565 | ||||||||
571 | ||||||||
591 | ||||||||
597 | ||||||||
631 | ||||||||
632 | ||||||||
698 | ||||||||
699 | ||||||||
701 | ||||||||
702 | ||||||||
703 | ||||||||
705 | ||||||||
706 | ||||||||
707 | ||||||||
708 | ||||||||
709 | ||||||||
710 | ||||||||
711 | ||||||||
718 | ||||||||
721 | ||||||||
725 | ||||||||
733 | ||||||||
736 | ||||||||
743 | ||||||||
745 | ||||||||
816 | ||||||||
817 | ||||||||
818 | ||||||||
819 | ||||||||
820 | ||||||||
821 | ||||||||
822 | ||||||||
823 | ||||||||
824 | ||||||||
825 | ||||||||
826 | ||||||||
827 | ||||||||
828 | ||||||||
829 | ||||||||
830 | ||||||||
831 | ||||||||
832 | ||||||||
833 | ||||||||
834 | ||||||||
835 | ||||||||
836 | ||||||||
837 | ||||||||
838 | ||||||||
839 | ||||||||
840 | ||||||||
843 | ||||||||
845 | ||||||||
847 | ||||||||
848 | ||||||||
850 | ||||||||
961 | ||||||||
1052 | ||||||||
1053 | ||||||||
1054 | ||||||||
1055 | ||||||||
1056 | ||||||||
1057 | ||||||||
1059 | ||||||||
1060 | ||||||||
1061 | ||||||||
1063 | ||||||||
1067 | ||||||||
1068 | ||||||||
1070 | ||||||||
1071 | ||||||||
1072 | ||||||||
1242 | ||||||||
1243 | ||||||||
1295 | ||||||||
1385 | ||||||||
1388 | ||||||||
1389 | ||||||||
1391 | ||||||||
1392 | ||||||||
1468 | ||||||||
1472 | ||||||||
1477 | ||||||||
1552 | ||||||||
1555 | ||||||||
1556 | ||||||||
1557 | ||||||||
1558 | ||||||||
1572 | ||||||||
1676 | ||||||||
1719 | ||||||||
1789 | ||||||||
2002 | ||||||||
2017 | ||||||||
2030 | ||||||||
2031 | ||||||||
2036 | ||||||||
2069 | ||||||||
2070 | ||||||||
2071 | ||||||||
2325 | ||||||||
2326 | ||||||||
2334 | ||||||||
2336 | ||||||||
2422 | ||||||||
2653 | ||||||||
2654 | ||||||||
2655 | ||||||||
2657 | ||||||||
2658 | ||||||||
2659 | ||||||||
2771 | ||||||||
2793 | ||||||||
2795 | ||||||||
2796 | ||||||||
2820 | ||||||||
2821 | ||||||||
2822 | ||||||||
3048 | ||||||||
3050 | ||||||||
3051 | ||||||||
3052 | ||||||||
3136 | ||||||||
3147 | ||||||||
3148 | ||||||||
3149 | ||||||||
3163 | ||||||||
3164 | ||||||||
3165 | ||||||||
3518 | ||||||||
3519 | ||||||||
In_pos_neg_data (22) | ||||||||
Marked_rearrangement | mIn1[unc-4(e120) dpy-10(e128)] | |||||||
mIn1[unc-4(e120)] | ||||||||
Description | Phenotype (24) | |||||||
Phenotype_not_observed | WBPhenotype:0000641 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Healthy, active. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Reference (54) | ||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006744 Donor | |||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Method | Substitution_allele |