WormBase Tree Display for Variation: WBVar00143004
expand all nodes | collapse all nodes | view schema
WBVar00143004 | Evidence | Person_evidence | WBPerson261 | ||
---|---|---|---|---|---|
WBPerson2629 | |||||
Name | Public_name | e164 | |||
Other_name | CE11066:p.Gln189Ter | ||||
F54D8.1.1:c.565C>T | |||||
HGVSg | CHROMOSOME_III:g.5107949C>T | ||||
Sequence_details | SMap | S_parent | Sequence | F54D8 | |
Flanking_sequences | gacggagaagatgctgatgatgccaaggct | agactcaacaatacgatggatgcttcactt | |||
Mapping_target | F54D8 | ||||
Type_of_mutation | Substitution | c | t | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin (4) | |||||
Affects | Gene | WBGene00001076 | |||
Transcript | F54D8.1.1 | VEP_consequence | stop_gained | ||
VEP_impact | HIGH | ||||
HGVSc | F54D8.1.1:c.565C>T | ||||
HGVSp | CE11066:p.Gln189Ter | ||||
cDNA_position | 568 | ||||
CDS_position | 565 | ||||
Protein_position | 189 | ||||
Exon_number | 3/4 | ||||
Codon_change | Cag/Tag | ||||
Amino_acid_change | Q/* | ||||
Interactor | WBInteraction000502314 | ||||
WBInteraction000537325 | |||||
Genetics | Interpolated_map_position | III | -2.13511 | ||
Mapping_data | In_2_point (29) | ||||
In_multi_point (150) | |||||
In_pos_neg_data | 1578 | ||||
1582 | |||||
1586 | |||||
1596 | |||||
1616 | |||||
3244 | |||||
Description (2) | |||||
Reference (20) | |||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||
Method | Substitution_allele |