WormBase Tree Display for Variation: WBVar00143022
expand all nodes | collapse all nodes | view schema
WBVar00143022 | Evidence | Paper_evidence | WBPaper00027121 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e188 | |||||||
Other_name | e188ts | ||||||||
H27M09.4.1:c.415G>C | |||||||||
CE25036:p.Gly139Arg | |||||||||
HGVSg | CHROMOSOME_I:g.6844486G>C | ||||||||
Sequence_details | SMap | S_parent | Sequence | H27M09 | |||||
Flanking_sequences | acatgccaacaaggaaaggctggaccacca | gaccaccaggagatgatggaaaggacggaa | |||||||
Mapping_target | H27M09 | ||||||||
Type_of_mutation | Substitution | g | c | Paper_evidence | WBPaper00027121 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (62) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001075 | |||||||
Transcript | H27M09.4.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious | |||||||
PolyPhen | 1 | probably_damaging | |||||||
HGVSc | H27M09.4.1:c.415G>C | ||||||||
HGVSp | CE25036:p.Gly139Arg | ||||||||
cDNA_position | 449 | ||||||||
CDS_position | 415 | ||||||||
Protein_position | 139 | ||||||||
Exon_number | 4/6 | ||||||||
Codon_change | Gga/Cga | ||||||||
Amino_acid_change | G/R | ||||||||
Interactor | WBInteraction000518462 | ||||||||
Genetics | Interpolated_map_position | I | 1.37773 | ||||||
Mapping_data | In_2_point | 5 | |||||||
241 | |||||||||
242 | |||||||||
5116 | |||||||||
5118 | |||||||||
6055 | |||||||||
In_multi_point (66) | |||||||||
In_pos_neg_data | 511 | ||||||||
3963 | |||||||||
3971 | |||||||||
3978 | |||||||||
3989 | |||||||||
3997 | |||||||||
4022 | |||||||||
4027 | |||||||||
4033 | |||||||||
4041 | |||||||||
4049 | |||||||||
4055 | |||||||||
4062 | |||||||||
4069 | |||||||||
4073 | |||||||||
4079 | |||||||||
4089 | |||||||||
4989 | |||||||||
4995 | |||||||||
5001 | |||||||||
5046 | |||||||||
5057 | |||||||||
5062 | |||||||||
5070 | |||||||||
5091 | |||||||||
5316 | |||||||||
5333 | |||||||||
5339 | |||||||||
5347 | |||||||||
5352 | |||||||||
6166 | |||||||||
6198 | |||||||||
6315 | |||||||||
6359 | |||||||||
6375 | |||||||||
6405 | |||||||||
6434 | |||||||||
6452 | |||||||||
6467 | |||||||||
6473 | |||||||||
6480 | |||||||||
6487 | |||||||||
6492 | |||||||||
6499 | |||||||||
6507 | |||||||||
6523 | |||||||||
6529 | |||||||||
6552 | |||||||||
6596 | |||||||||
6603 | |||||||||
6608 | |||||||||
6614 | |||||||||
6626 | |||||||||
6644 | |||||||||
6660 | |||||||||
Description | Phenotype | WBPhenotype:0000035 | Paper_evidence | WBPaper00000031 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000062 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ts lethal (25C). Lethality enhanced by Smg. ES3 (all stages 20C). | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000519 | Paper_evidence | WBPaper00033444 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutant strains tested showed altered fitness compared to wild type when exposed to different bacterial environments such as E. coli, M. luteus, and Pseudomonas sp.and B. megaterium | Paper_evidence | WBPaper00033444 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00000031 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Medium dumpy adult, strong dumpy L1 (20C). Easy to score (ES3) at all stages (20C). | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00001328 | ||||||||
WBPaper00000031 | |||||||||
WBPaper00004883 | |||||||||
WBPaper00024024 | |||||||||
WBPaper00014397 | |||||||||
WBPaper00016102 | |||||||||
WBPaper00025792 | |||||||||
WBPaper00033444 | |||||||||
WBPaper00061175 | |||||||||
Remark | Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||||
Method | Substitution_allele |