WormBase Tree Display for Variation: WBVar00143022
expand all nodes | collapse all nodes | view schema
WBVar00143022 | Evidence | Paper_evidence | WBPaper00027121 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e188 | |||||
Other_name | e188ts | ||||||
H27M09.4.1:c.415G>C | |||||||
CE25036:p.Gly139Arg | |||||||
HGVSg | CHROMOSOME_I:g.6844486G>C | ||||||
Sequence_details | SMap | S_parent | Sequence | H27M09 | |||
Flanking_sequences | acatgccaacaaggaaaggctggaccacca | gaccaccaggagatgatggaaaggacggaa | |||||
Mapping_target | H27M09 | ||||||
Type_of_mutation | Substitution | g | c | Paper_evidence | WBPaper00027121 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (62) | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects (3) | |||||||
Genetics | Interpolated_map_position | I | 1.37773 | ||||
Mapping_data | In_2_point | 5 | |||||
241 | |||||||
242 | |||||||
5116 | |||||||
5118 | |||||||
6055 | |||||||
In_multi_point (66) | |||||||
In_pos_neg_data (55) | |||||||
Description (2) | |||||||
Reference | WBPaper00001328 | ||||||
WBPaper00000031 | |||||||
WBPaper00004883 | |||||||
WBPaper00024024 | |||||||
WBPaper00014397 | |||||||
WBPaper00016102 | |||||||
WBPaper00025792 | |||||||
WBPaper00033444 | |||||||
WBPaper00061175 | |||||||
Remark | Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Method | Substitution_allele |