WormBase Tree Display for Variation: WBVar00143022
expand all nodes | collapse all nodes | view schema
WBVar00143022 | Evidence | Paper_evidence | WBPaper00027121 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e188 | |||||||
Other_name | e188ts | ||||||||
H27M09.4.1:c.415G>C | |||||||||
CE25036:p.Gly139Arg | |||||||||
HGVSg | CHROMOSOME_I:g.6844486G>C | ||||||||
Sequence_details | SMap | S_parent | Sequence | H27M09 | |||||
Flanking_sequences | acatgccaacaaggaaaggctggaccacca | gaccaccaggagatgatggaaaggacggaa | |||||||
Mapping_target | H27M09 | ||||||||
Type_of_mutation | Substitution | g | c | Paper_evidence | WBPaper00027121 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (62) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001075 | |||||||
Transcript | H27M09.4.1 (12) | ||||||||
Interactor | WBInteraction000518462 | ||||||||
Genetics | Interpolated_map_position | I | 1.37773 | ||||||
Mapping_data | In_2_point | 5 | |||||||
241 | |||||||||
242 | |||||||||
5116 | |||||||||
5118 | |||||||||
6055 | |||||||||
In_multi_point | 12 | ||||||||
231 | |||||||||
236 | |||||||||
237 | |||||||||
241 | |||||||||
242 | |||||||||
243 | |||||||||
244 | |||||||||
248 | |||||||||
250 | |||||||||
251 | |||||||||
279 | |||||||||
283 | |||||||||
290 | |||||||||
345 | |||||||||
346 | |||||||||
431 | |||||||||
432 | |||||||||
433 | |||||||||
435 | |||||||||
438 | |||||||||
439 | |||||||||
443 | |||||||||
446 | |||||||||
447 | |||||||||
449 | |||||||||
450 | |||||||||
710 | |||||||||
814 | |||||||||
1223 | |||||||||
1232 | |||||||||
1235 | |||||||||
1274 | |||||||||
1460 | |||||||||
1461 | |||||||||
1462 | |||||||||
1463 | |||||||||
1464 | |||||||||
1465 | |||||||||
1466 | |||||||||
1694 | |||||||||
1784 | |||||||||
1889 | |||||||||
1890 | |||||||||
1892 | |||||||||
2000 | |||||||||
2089 | |||||||||
2140 | |||||||||
2141 | |||||||||
2142 | |||||||||
2143 | |||||||||
2144 | |||||||||
2145 | |||||||||
2146 | |||||||||
2147 | |||||||||
2148 | |||||||||
2149 | |||||||||
2150 | |||||||||
2281 | |||||||||
2282 | |||||||||
2459 | |||||||||
2468 | |||||||||
3004 | |||||||||
3005 | |||||||||
3196 | |||||||||
3513 | |||||||||
In_pos_neg_data (55) | |||||||||
Description | Phenotype | WBPhenotype:0000035 | Paper_evidence | WBPaper00000031 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000062 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ts lethal (25C). Lethality enhanced by Smg. ES3 (all stages 20C). | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000519 | Paper_evidence | WBPaper00033444 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutant strains tested showed altered fitness compared to wild type when exposed to different bacterial environments such as E. coli, M. luteus, and Pseudomonas sp.and B. megaterium | Paper_evidence | WBPaper00033444 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00000031 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed (2) | |||||||||
Remark | Medium dumpy adult, strong dumpy L1 (20C). Easy to score (ES3) at all stages (20C). | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00001328 | ||||||||
WBPaper00000031 | |||||||||
WBPaper00004883 | |||||||||
WBPaper00024024 | |||||||||
WBPaper00014397 | |||||||||
WBPaper00016102 | |||||||||
WBPaper00025792 | |||||||||
WBPaper00033444 | |||||||||
WBPaper00061175 | |||||||||
Remark | Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||||
Method | Substitution_allele |