WormBase Tree Display for Variation: WBVar00143061
expand all nodes | collapse all nodes | view schema
WBVar00143061 | Evidence | Paper_evidence | WBPaper00004985 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e245 | ||||||
Other_name | ZC416.8a.1:c.1039G>C | |||||||
ZC416.8b.1:c.1-1285G>C | ||||||||
CE17307:p.Gly347Arg | ||||||||
HGVSg | CHROMOSOME_IV:g.3619060C>G | |||||||
Sequence_details | SMap | S_parent | Sequence | ZC416 | ||||
Flanking_sequences | gcgattgctatggttgggttggctatggag | gaatcgcgtgttttgcaatcccctatacca | ||||||
Mapping_target | ZC416 | |||||||
Type_of_mutation | Substitution | g | m | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (17) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006756 | ||||||
WBGene00000481 | ||||||||
Transcript | ZC416.8a.1 (12) | |||||||
ZC416.8b.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | ZC416.8b.1:c.1-1285G>C | |||||||
Intron_number | 1/11 | |||||||
Interactor | WBInteraction000518365 | |||||||
WBInteraction000518556 | ||||||||
WBInteraction000518559 | ||||||||
WBInteraction000518561 | ||||||||
WBInteraction000518851 | ||||||||
WBInteraction000518855 | ||||||||
WBInteraction000519040 | ||||||||
WBInteraction000519045 | ||||||||
WBInteraction000519046 | ||||||||
Genetics | Interpolated_map_position | IV | -3.11559 | |||||
Mapping_data | In_2_point | 103 | ||||||
728 | ||||||||
1646 | ||||||||
1647 | ||||||||
2757 | ||||||||
In_multi_point | 96 | |||||||
101 | ||||||||
104 | ||||||||
275 | ||||||||
455 | ||||||||
456 | ||||||||
457 | ||||||||
458 | ||||||||
459 | ||||||||
460 | ||||||||
461 | ||||||||
462 | ||||||||
463 | ||||||||
464 | ||||||||
465 | ||||||||
466 | ||||||||
596 | ||||||||
610 | ||||||||
623 | ||||||||
684 | ||||||||
691 | ||||||||
742 | ||||||||
900 | ||||||||
901 | ||||||||
904 | ||||||||
1127 | ||||||||
1132 | ||||||||
1517 | ||||||||
1523 | ||||||||
3063 | ||||||||
3132 | ||||||||
5675 | ||||||||
Description | Phenotype (14) | |||||||
Phenotype_not_observed | WBPhenotype:0000123 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | normal ChAT (choline acetyltransferase) levels | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals do not exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001853 | Paper_evidence | WBPaper00035150 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutant response to AAD 1470 was comparable to that observed in wild-type | Paper_evidence | WBPaper00035150 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (22) | ||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006756 Missense 347 G to R | |||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000481 Intron Inferred_automatically map_Alleles.pl | ||||||||
Method | Substitution_allele |