WormBase Tree Display for Variation: WBVar00143063
expand all nodes | collapse all nodes | view schema
WBVar00143063 | Evidence | Paper_evidence | WBPaper00031175 | |||||
---|---|---|---|---|---|---|---|---|
Name (3) | ||||||||
Sequence_details | SMap | S_parent | Sequence | C50C3 | ||||
Flanking_sequences | cattataaagaatctggacaattatcttggt | gactggagtttacagagaaagattggtgagt | ||||||
Mapping_target | C50C3 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00031175 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (67) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006772 | ||||||
Transcript | C50C3.9a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | C50C3.9a.1:c.1487G>A | |||||||
HGVSp | CE32168:p.Trp496Ter | |||||||
cDNA_position | 1588 | |||||||
CDS_position | 1487 | |||||||
Protein_position | 496 | |||||||
Exon_number | 9/18 | |||||||
Codon_change | tGg/tAg | |||||||
Amino_acid_change | W/* | |||||||
C50C3.9c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C50C3.9c.1:c.1355G>A | |||||||
HGVSp | CE24860:p.Trp452Ter | |||||||
cDNA_position | 1467 | |||||||
CDS_position | 1355 | |||||||
Protein_position | 452 | |||||||
Exon_number | 8/17 | |||||||
Codon_change | tGg/tAg | |||||||
Amino_acid_change | W/* | |||||||
Interactor | WBInteraction000052098 | |||||||
WBInteraction000052102 | ||||||||
WBInteraction000502423 | ||||||||
WBInteraction000502424 | ||||||||
Genetics | Interpolated_map_position | III | -0.373497 | |||||
Mapping_data | In_2_point (12) | |||||||
In_multi_point | 76 | |||||||
368 | ||||||||
369 | ||||||||
370 | ||||||||
376 | ||||||||
377 | ||||||||
378 | ||||||||
379 | ||||||||
389 | ||||||||
406 | ||||||||
409 | ||||||||
412 | ||||||||
428 | ||||||||
429 | ||||||||
430 | ||||||||
559 | ||||||||
756 | ||||||||
872 | ||||||||
874 | ||||||||
877 | ||||||||
878 | ||||||||
1093 | ||||||||
1100 | ||||||||
1101 | ||||||||
1109 | ||||||||
1110 | ||||||||
1113 | ||||||||
1397 | ||||||||
1403 | ||||||||
1405 | ||||||||
1406 | ||||||||
1407 | ||||||||
1410 | ||||||||
1411 | ||||||||
1413 | ||||||||
1417 | ||||||||
1419 | ||||||||
1484 | ||||||||
1486 | ||||||||
1494 | ||||||||
1623 | ||||||||
1624 | ||||||||
1634 | ||||||||
1639 | ||||||||
1662 | ||||||||
1667 | ||||||||
1753 | ||||||||
1755 | ||||||||
1886 | ||||||||
1903 | ||||||||
1904 | ||||||||
1907 | ||||||||
2056 | ||||||||
2104 | ||||||||
2130 | ||||||||
2178 | ||||||||
2180 | ||||||||
2181 | ||||||||
2182 | ||||||||
2186 | ||||||||
2187 | ||||||||
2188 | ||||||||
2189 | ||||||||
2217 | ||||||||
2242 | ||||||||
2243 | ||||||||
2247 | ||||||||
2743 | ||||||||
2761 | ||||||||
3167 | ||||||||
3168 | ||||||||
3169 | ||||||||
3170 | ||||||||
3175 | ||||||||
3178 | ||||||||
3191 | ||||||||
3192 | ||||||||
3297 | ||||||||
3298 | ||||||||
3299 | ||||||||
3300 | ||||||||
3301 | ||||||||
3302 | ||||||||
3305 | ||||||||
3306 | ||||||||
3387 | ||||||||
In_pos_neg_data | 807 | |||||||
818 | ||||||||
1617 | ||||||||
3807 | ||||||||
Description | Phenotype (20) | |||||||
Phenotype_not_observed | WBPhenotype:0001182 | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants had wild-type fat content | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Fat content was visualized by Nile red staining | Paper_evidence | WBPaper00031915 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table 1 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001811 | Paper_evidence | WBPaper00031915 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants were susceptible to the fat-reducing effects of exogenously administered serotonin | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Reduced fat content of 5-HT-treated animals was visualized by Nile red staining and confirmed by thin-layer chromatography (TLC) quantitation of total triglycerides extracted from vehicle- and 5-HT-treated worms and by Sudan black fat staining | Paper_evidence | WBPaper00031915 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (30) | ||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006772 Amber_UAG_or_Opal_UGA | |||||||
Method | Substitution_allele |