WormBase Tree Display for Variation: WBVar00143078
expand all nodes | collapse all nodes | view schema
WBVar00143078 | Evidence | Paper_evidence | WBPaper00041162 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e271 | |||||||
Other_name | CE25115:p.Arg824Ter | ||||||||
T19B4.7.1:c.2470C>T | |||||||||
HGVSg | CHROMOSOME_I:g.5683473G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T19B4 | |||||
Flanking_sequences | ggatctggatttccgatttatgagactgtc | gaacattgtctcgtgaaactccatcacatt | |||||||
Mapping_target | T19B4 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00041162 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00003970 | ||||||||
WBStrain00003972 | |||||||||
WBStrain00004141 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006776 | |||||||
Transcript | T19B4.7.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T19B4.7.1:c.2470C>T | ||||||||
HGVSp | CE25115:p.Arg824Ter | ||||||||
cDNA_position | 2533 | ||||||||
CDS_position | 2470 | ||||||||
Protein_position | 824 | ||||||||
Exon_number | 13/19 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Interactor (16) | |||||||||
Genetics (2) | |||||||||
Description | Phenotype (18) | ||||||||
Phenotype_not_observed | WBPhenotype:0000104 | Paper_evidence | WBPaper00035117 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | INA-1/PAT-3::GFP was localized normally in unc-40(e271) mutant animals | Paper_evidence | WBPaper00035117 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00040857 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutation did not cause SNB-1::VENUS localization defects. | Paper_evidence | WBPaper00040857 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00036484 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | MADD-2::GFP was excluded from the dorsal ADL branch and was present at high levels in the cell body, a pattern that was also observed in control animals. | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005661 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (15) | |||||||||
Method | Substitution_allele |