WormBase Tree Display for Variation: WBVar00143164
expand all nodes | collapse all nodes | view schema
WBVar00143164 | Evidence | Paper_evidence | WBPaper00003576 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e382 | |||||||
Other_name (13) | |||||||||
HGVSg | CHROMOSOME_III:g.10527973G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T21C12 | |||||
Flanking_sequences | ttgagaacggagacaccgattttgcagacg | gtacgagacgaaagatatcgactactattg | |||||||
Mapping_target | T21C12 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003576 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00006784 | |||||||
Transcript | T21C12.1k.1 (12) | ||||||||
T21C12.1m.1 (12) | |||||||||
T21C12.1c.1 (12) | |||||||||
T21C12.1e.1 (12) | |||||||||
T21C12.1c.2 (12) | |||||||||
T21C12.1o.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | T21C12.1o.1:c.59-2613G>A | ||||||||
Intron_number | 1/5 | ||||||||
T21C12.1d.1 (12) | |||||||||
T21C12.1f.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | T21C12.1f.1:c.563-2613G>A | ||||||||
Intron_number | 6/11 | ||||||||
Interactor | WBInteraction000517364 | ||||||||
WBInteraction000562870 | |||||||||
Genetics (2) | |||||||||
Description | Phenotype (13) | ||||||||
Phenotype_not_observed | WBPhenotype:0001232 | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Male tail curling in response to serotonin is similar to WT. | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004929 | Paper_evidence | WBPaper00001861 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001861 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00038249 | ||||||||
WBPaper00041069 | |||||||||
WBPaper00000031 | |||||||||
WBPaper00010938 | |||||||||
WBPaper00022718 | |||||||||
WBPaper00035082 | |||||||||
WBPaper00001861 | |||||||||
WBPaper00003576 | |||||||||
WBPaper00042154 | |||||||||
WBPaper00045634 | |||||||||
Remark | affects UNC-49B subunit only | ||||||||
Method | Substitution_allele |