WormBase Tree Display for Variation: WBVar00143229
expand all nodes | collapse all nodes | view schema
WBVar00143229 | Evidence | Paper_evidence | WBPaper00006355 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e459 | |||||||
Other_name | Y59A8B.1a.1:c.3872G>A | ||||||||
CE26205:p.Gly1291Glu | |||||||||
HGVSg | CHROMOSOME_V:g.17940935C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y59A8B | |||||
Flanking_sequences | aaaacaatggagtacccctatttgccatcg | agtaatggaaaatgcggcagaagcgctgca | |||||||
Mapping_target | Y59A8B | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001080 | |||||||
Transcript | Y59A8B.1a.1 (12) | ||||||||
Interactor | WBInteraction000052181 | ||||||||
WBInteraction000052433 | |||||||||
Genetics | Interpolated_map_position | V | 13.3322 | ||||||
Mapping_data (2) | |||||||||
Description | Phenotype | WBPhenotype:0000583 | Paper_evidence | WBPaper00000666 | |||||
WBPaper00001011 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XX animals are Dumpy; XO animals are not Dumpy. | Paper_evidence | WBPaper00000666 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
XX animals are dumpy. | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000666 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000718 | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | As determined by the penetrance of the lin-14(n179) mutant phenotype, based on the [# mutant seam cell nuclei (undivided seam cell nuclei + nuclei that generated precocious alae)/ total # seam cell nuclei] animals after the L3 molt. | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Nomarski optics were used to follow the fates of the midbody seam cell nuclei of L3 animals raised at 24C. | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | lin-14(n179) | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001581 | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals have 26%(n=20) mutant seam cell nuclei, similar to XXX lin-14 animals (26% n=25) and less mutant than XX lin-14 animals (77% n=40). | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006913 | PATO:0000460 | Paper_evidence | WBPaper00001011 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Nomarski optics were used to follow the fates of the midbody seam cell nuclei of L3 animals raised at 24C. | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | lin-14(n179) | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001582 | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XO lin-14(n179) males display significantly more lin-14 seam cell defects than lin-14 animals alone but similar to levels observed for lin-14/Df animals. Similar results were observed for e428/e459 (data not shown). | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001011 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | lin-14(n179) | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001583 | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XXX and XXXX progeny are lethal. | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000520 | Paper_evidence | WBPaper00000666 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XO males are morphologically indistinguishable from wild type males. | Paper_evidence | WBPaper00000666 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000666 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000666 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000648 | Paper_evidence | WBPaper00000666 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XO males are not mating deficient relative to wild type males in fertility measurements. | Paper_evidence | WBPaper00000666 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000666 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000666 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00016180 | ||||||||
WBPaper00001011 | |||||||||
WBPaper00000666 | |||||||||
WBPaper00006355 | |||||||||
WBPaper00013900 | |||||||||
Method | Substitution_allele |