WormBase Tree Display for Variation: WBVar00143286
expand all nodes | collapse all nodes | view schema
WBVar00143286 | Evidence | Person_evidence | WBPerson298 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e540 | |||||
Other_name | K11C4.5o.1:c.9049-1G>A | ||||||
K11C4.5d.1:c.8707-1G>A | |||||||
K11C4.5e.1:c.9055-1G>A | |||||||
K11C4.5l.1:c.8701-1G>A | |||||||
K11C4.5m.1:c.9049-1G>A | |||||||
K11C4.5c.1:c.9055-1G>A | |||||||
K11C4.5b.1:c.8707-1G>A | |||||||
K11C4.5f.1:c.8707-1G>A | |||||||
K11C4.5n.1:c.8701-1G>A | |||||||
K11C4.5k.1:c.9049-1G>A | |||||||
K11C4.5g.1:c.9055-1G>A | |||||||
K11C4.5i.1:c.9049-1G>A | |||||||
K11C4.5p.1:c.8701-1G>A | |||||||
K11C4.5a.1:c.9055-1G>A | |||||||
K11C4.5j.1:c.8701-1G>A | |||||||
K11C4.5h.1:c.8707-1G>A | |||||||
HGVSg | CHROMOSOME_V:g.6912855C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | K11C4 | |||
Flanking_sequences | tgagcatctctccttgtagaatgatttttc | tgaaaaaaaaaagaaaattgttgttaacat | |||||
Mapping_target | K11C4 | ||||||
Type_of_mutation | Substitution | C | T | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00000489 | ||||||
WBStrain00004179 | |||||||
WBStrain00008434 | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006801 | |||||
Transcript (16) | |||||||
Interactor | WBInteraction000501717 | ||||||
WBInteraction000502865 | |||||||
WBInteraction000504811 | |||||||
WBInteraction000520126 | |||||||
WBInteraction000524783 | |||||||
WBInteraction000556209 | |||||||
WBInteraction000556212 | |||||||
Genetics | Interpolated_map_position | V | 0.473391 | ||||
Mapping_data | In_2_point | 310 | |||||
3136 | |||||||
In_multi_point (11) | |||||||
In_pos_neg_data | 847 | ||||||
1743 | |||||||
1749 | |||||||
1775 | |||||||
3073 | |||||||
3082 | |||||||
3432 | |||||||
Description | Phenotype (7) | ||||||
Phenotype_not_observed | WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Reference (20) | |||||||
Remark | We sequenced e540 for Mueller, et al (eLife, in revision). e540 is a splice acceptor mutation. alt_det = V: 6912855C>T mut_det = G>A in splice acceptor upstream of exon 23 in unc-68 | Person_evidence | WBPerson298 | ||||
Curator_confirmed | WBPerson51134 | ||||||
Variation information submitted by WBPerson298 on 2022-10-25_12:05:38 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||||
Method | Substitution_allele |