WormBase Tree Display for Variation: WBVar00143365
expand all nodes | collapse all nodes | view schema
WBVar00143365 | Evidence | Paper_evidence | WBPaper00005629 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e644 | |||||||
Other_name (20) | |||||||||
HGVSg | CHROMOSOME_V:g.4505497G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T28F12 | |||||
Flanking_sequences | caaaggaggcgattaccaaattccgcgcgt | gttatttcacaatttgacggtaagggtgca | |||||||
Mapping_target | T28F12 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005629 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00006796 | |||||||
Transcript (17) | |||||||||
Interactor (8) | |||||||||
Genetics | Interpolated_map_position | V | -5.18024 | ||||||
Mapping_data | In_2_point | 125 | |||||||
In_multi_point | 143 | ||||||||
1524 | |||||||||
3277 | |||||||||
In_pos_neg_data | 846 | ||||||||
2870 | |||||||||
2871 | |||||||||
2872 | |||||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00025190 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00025190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000070 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | male tail abnormal | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000342 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | bursa small | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | slightly dumpy | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||||
WBPaper00001474 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | irregular, sometimes rippling movement, especially in reverse | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Unc | Paper_evidence | WBPaper00001474 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | slightly slow | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001226 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | variable abnormalities in VD and DD commissures | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005303 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005270 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001364 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | fan reduced | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001492 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 19% of embryos Nob | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | 19% | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001509 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | rays variably absent | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00001474 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | viable Unc allele | Paper_evidence | WBPaper00001474 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (12) | |||||||||
Method | Substitution_allele |