WormBase Tree Display for Variation: WBVar00143369
expand all nodes | collapse all nodes | view schema
WBVar00143369 | Name | Public_name | e648 | ||||
---|---|---|---|---|---|---|---|
Other_name | CE24899:p.Trp101Ter | ||||||
F14F3.1a.1:c.303G>A | |||||||
F14F3.1a.2:c.303G>A | |||||||
HGVSg | CHROMOSOME_X:g.10511192G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | F14F3 | |||
Flanking_sequences | acaaacgtgaccaacctagcatttttgcatg | gaaatcagagataaactgctagctgataat | |||||
Mapping_target | F14F3 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002236 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004190 | ||||||
Laboratory | CB | ||||||
CX | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00006870 | |||||
Transcript | F14F3.1a.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | F14F3.1a.1:c.303G>A | ||||||
HGVSp | CE24899:p.Trp101Ter | ||||||
cDNA_position | 605 | ||||||
CDS_position | 303 | ||||||
Protein_position | 101 | ||||||
Exon_number | 6/14 | ||||||
Codon_change | tgG/tgA | ||||||
Amino_acid_change | W/* | ||||||
F14F3.1a.2 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | F14F3.1a.2:c.303G>A | ||||||
HGVSp | CE24899:p.Trp101Ter | ||||||
cDNA_position | 395 | ||||||
CDS_position | 303 | ||||||
Protein_position | 101 | ||||||
Exon_number | 5/13 | ||||||
Codon_change | tgG/tgA | ||||||
Amino_acid_change | W/* | ||||||
Interactor | WBInteraction000003443 | ||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00002236 | |||
Genetics | Interpolated_map_position | X | 2.22423 | ||||
Mapping_data | In_2_point | 164 | |||||
3647 | |||||||
3649 | |||||||
3652 | |||||||
3658 | |||||||
3668 | |||||||
In_multi_point (15) | |||||||
In_pos_neg_data | 293 | ||||||
498 | |||||||
874 | |||||||
3646 | |||||||
4979 | |||||||
4981 | |||||||
Description (2) | |||||||
Reference | WBPaper00006052 | ||||||
WBPaper00021796 | |||||||
WBPaper00003665 | |||||||
WBPaper00003760 | |||||||
WBPaper00014771 | |||||||
WBPaper00004825 | |||||||
WBPaper00014973 | |||||||
WBPaper00014314 | |||||||
WBPaper00017246 | |||||||
WBPaper00016625 | |||||||
Remark | This allele has the same nucleotide mutation at the same position as ky664. It is mutated with the same mutagen as ky664, but obtained using a diferent screen. | Paper_evidence | WBPaper00002236 | ||||
Method | Substitution_allele |