WormBase Tree Display for Variation: WBVar00143369
expand all nodes | collapse all nodes | view schema
WBVar00143369 | Name | Public_name | e648 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE24899:p.Trp101Ter | |||||||
F14F3.1a.1:c.303G>A | ||||||||
F14F3.1a.2:c.303G>A | ||||||||
HGVSg | CHROMOSOME_X:g.10511192G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F14F3 | ||||
Flanking_sequences | acaaacgtgaccaacctagcatttttgcatg | gaaatcagagataaactgctagctgataat | ||||||
Mapping_target | F14F3 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002236 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004190 | |||||||
Laboratory | CB | |||||||
CX | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006870 | ||||||
Transcript | F14F3.1a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | F14F3.1a.1:c.303G>A | |||||||
HGVSp | CE24899:p.Trp101Ter | |||||||
cDNA_position | 605 | |||||||
CDS_position | 303 | |||||||
Protein_position | 101 | |||||||
Exon_number | 6/14 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
F14F3.1a.2 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F14F3.1a.2:c.303G>A | |||||||
HGVSp | CE24899:p.Trp101Ter | |||||||
cDNA_position | 395 | |||||||
CDS_position | 303 | |||||||
Protein_position | 101 | |||||||
Exon_number | 5/13 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
Interactor | WBInteraction000003443 | |||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00002236 | ||||
Genetics | Interpolated_map_position | X | 2.22423 | |||||
Mapping_data | In_2_point | 164 | ||||||
3647 | ||||||||
3649 | ||||||||
3652 | ||||||||
3658 | ||||||||
3668 | ||||||||
In_multi_point (15) | ||||||||
In_pos_neg_data | 293 | |||||||
498 | ||||||||
874 | ||||||||
3646 | ||||||||
4979 | ||||||||
4981 | ||||||||
Description | Phenotype (10) | |||||||
Phenotype_not_observed | WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00006052 | |||||||
WBPaper00021796 | ||||||||
WBPaper00003665 | ||||||||
WBPaper00003760 | ||||||||
WBPaper00014771 | ||||||||
WBPaper00004825 | ||||||||
WBPaper00014973 | ||||||||
WBPaper00014314 | ||||||||
WBPaper00017246 | ||||||||
WBPaper00016625 | ||||||||
Remark | This allele has the same nucleotide mutation at the same position as ky664. It is mutated with the same mutagen as ky664, but obtained using a diferent screen. | Paper_evidence | WBPaper00002236 | |||||
Method | Substitution_allele |