WormBase Tree Display for Variation: WBVar00143469
expand all nodes | collapse all nodes | view schema
| WBVar00143469 | Evidence | Paper_evidence | WBPaper00006395 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e767 | |||||
| Other_name (3) | |||||||
| HGVSg | CHROMOSOME_I:g.152861C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | F56C11 | |||
| Flanking_sequences | tgaatgagaatccaggtcttctctcatttg | tctgatcctcttccgttggcataactacaa | |||||
| Mapping_target | F56C11 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00006395 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00004204 | ||||||
| WBStrain00026835 | |||||||
| WBStrain00027251 | |||||||
| WBStrain00028999 | |||||||
| WBStrain00057323 | |||||||
| Component_of_genotype | WBGenotype00000015 | ||||||
| Laboratory | CB | ||||||
| SHU | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00000253 | |||||
| Transcript | F56C11.1.1 (12) | ||||||
| F56C11.1.2 (12) | |||||||
| Interactor | WBInteraction000537316 | ||||||
| Genetics | Interpolated_map_position | I | -19.1473 | ||||
| Mapping_data | In_2_point | 1 | |||||
| 2504 | |||||||
| 3941 | |||||||
| 4741 | |||||||
| 7166 | |||||||
| 7167 | |||||||
| In_multi_point | 390 | ||||||
| 392 | |||||||
| 979 | |||||||
| 1241 | |||||||
| 1294 | |||||||
| 2207 | |||||||
| 3200 | |||||||
| In_pos_neg_data | 6276 | ||||||
| Description (2) | |||||||
| Reference | WBPaper00001328 | ||||||
| WBPaper00000031 | |||||||
| WBPaper00005747 | |||||||
| WBPaper00033445 | |||||||
| WBPaper00051549 | |||||||
| WBPaper00061175 | |||||||
| WBPaper00065026 | |||||||
| WBPaper00065304 | |||||||
| WBPaper00065993 | |||||||
| Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||
| Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||
| Method | Substitution_allele |
