WormBase Tree Display for Variation: WBVar00143470
expand all nodes | collapse all nodes | view schema
WBVar00143470 | Evidence | Person_evidence | WBPerson10095 | ||
---|---|---|---|---|---|
Name | Public_name | e768 | |||
Other_name | CE11540:p.Gly179Glu | ||||
F59E12.2.1:c.1310+537C>T | |||||
F59E12.12.1:c.536G>A | |||||
HGVSg | CHROMOSOME_II:g.5651839C>T | ||||
Sequence_details | SMap | S_parent | Sequence | F59E12 | |
Flanking_sequences | ttcccgtttcttcctggttgtccctttgat | caatatttcctggtggtcctggtggcccta | |||
Mapping_target | F59E12 | ||||
Type_of_mutation | Substitution | c | t | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain (15) | |||||
Laboratory | CB | ||||
Status | Live | ||||
Affects | Gene | WBGene00000252 | |||
WBGene00006988 | |||||
Transcript | F59E12.12.1 (12) | ||||
F59E12.2.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | F59E12.2.1:c.1310+537C>T | ||||
Intron_number | 5/8 | ||||
Interactor (10) | |||||
Genetics | Interpolated_map_position | II | -0.988396 | ||
Mapping_data | In_2_point | 37 | |||
38 | |||||
39 | |||||
621 | |||||
3787 | |||||
4219 | |||||
4225 | |||||
In_multi_point (18) | |||||
In_pos_neg_data | 457 | ||||
1524 | |||||
1526 | |||||
1528 | |||||
1533 | |||||
7119 | |||||
Description (2) | |||||
Reference | WBPaper00001328 | ||||
WBPaper00000031 | |||||
WBPaper00000465 | |||||
WBPaper00016398 | |||||
WBPaper00016094 | |||||
WBPaper00061175 | |||||
WBPaper00061945 | |||||
Remark | Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||
Variation information submitted by WBPerson10095 on 2022-02-17_15:17:42 via the Allele submission form. Received data and remarks refer to the negative strand sequence (CDS). | Curator_confirmed | WBPerson51134 | |||
alt_det = g to a mut_det = G179E | Person_evidence | WBPerson10095 | |||
Curator_confirmed | WBPerson51134 | ||||
Method | Substitution_allele |